ID: 1197986261

View in Genome Browser
Species Human (GRCh38)
Location X:132269324-132269346
Sequence CACTGTGGTGGAAACGGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197986256_1197986261 -5 Left 1197986256 X:132269306-132269328 CCCTGCTCAAGTTGTTAGCACTG No data
Right 1197986261 X:132269324-132269346 CACTGTGGTGGAAACGGAATAGG No data
1197986255_1197986261 27 Left 1197986255 X:132269274-132269296 CCACAAGGGGTCAGGACAGGCAT No data
Right 1197986261 X:132269324-132269346 CACTGTGGTGGAAACGGAATAGG No data
1197986257_1197986261 -6 Left 1197986257 X:132269307-132269329 CCTGCTCAAGTTGTTAGCACTGT No data
Right 1197986261 X:132269324-132269346 CACTGTGGTGGAAACGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197986261 Original CRISPR CACTGTGGTGGAAACGGAAT AGG Intergenic
No off target data available for this crispr