ID: 1197986262

View in Genome Browser
Species Human (GRCh38)
Location X:132269346-132269368
Sequence GAGATCAATAAATATTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197986256_1197986262 17 Left 1197986256 X:132269306-132269328 CCCTGCTCAAGTTGTTAGCACTG No data
Right 1197986262 X:132269346-132269368 GAGATCAATAAATATTTTCTAGG No data
1197986257_1197986262 16 Left 1197986257 X:132269307-132269329 CCTGCTCAAGTTGTTAGCACTGT No data
Right 1197986262 X:132269346-132269368 GAGATCAATAAATATTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197986262 Original CRISPR GAGATCAATAAATATTTTCT AGG Intergenic
No off target data available for this crispr