ID: 1197986262 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:132269346-132269368 |
| Sequence | GAGATCAATAAATATTTTCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197986256_1197986262 | 17 | Left | 1197986256 | X:132269306-132269328 | CCCTGCTCAAGTTGTTAGCACTG | No data | ||
| Right | 1197986262 | X:132269346-132269368 | GAGATCAATAAATATTTTCTAGG | No data | ||||
| 1197986257_1197986262 | 16 | Left | 1197986257 | X:132269307-132269329 | CCTGCTCAAGTTGTTAGCACTGT | No data | ||
| Right | 1197986262 | X:132269346-132269368 | GAGATCAATAAATATTTTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197986262 | Original CRISPR | GAGATCAATAAATATTTTCT AGG | Intergenic | ||
| No off target data available for this crispr | |||||