ID: 1197986264 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:132269359-132269381 |
| Sequence | ATTTTCTAGGCCAGGCACAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 11371 | |||
| Summary | {0: 3, 1: 62, 2: 409, 3: 2335, 4: 8562} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197986256_1197986264 | 30 | Left | 1197986256 | X:132269306-132269328 | CCCTGCTCAAGTTGTTAGCACTG | No data | ||
| Right | 1197986264 | X:132269359-132269381 | ATTTTCTAGGCCAGGCACAGTGG | 0: 3 1: 62 2: 409 3: 2335 4: 8562 |
||||
| 1197986257_1197986264 | 29 | Left | 1197986257 | X:132269307-132269329 | CCTGCTCAAGTTGTTAGCACTGT | No data | ||
| Right | 1197986264 | X:132269359-132269381 | ATTTTCTAGGCCAGGCACAGTGG | 0: 3 1: 62 2: 409 3: 2335 4: 8562 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197986264 | Original CRISPR | ATTTTCTAGGCCAGGCACAG TGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||