ID: 1197986264

View in Genome Browser
Species Human (GRCh38)
Location X:132269359-132269381
Sequence ATTTTCTAGGCCAGGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11371
Summary {0: 3, 1: 62, 2: 409, 3: 2335, 4: 8562}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197986256_1197986264 30 Left 1197986256 X:132269306-132269328 CCCTGCTCAAGTTGTTAGCACTG No data
Right 1197986264 X:132269359-132269381 ATTTTCTAGGCCAGGCACAGTGG 0: 3
1: 62
2: 409
3: 2335
4: 8562
1197986257_1197986264 29 Left 1197986257 X:132269307-132269329 CCTGCTCAAGTTGTTAGCACTGT No data
Right 1197986264 X:132269359-132269381 ATTTTCTAGGCCAGGCACAGTGG 0: 3
1: 62
2: 409
3: 2335
4: 8562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197986264 Original CRISPR ATTTTCTAGGCCAGGCACAG TGG Intergenic
Too many off-targets to display for this crispr