ID: 1197994844

View in Genome Browser
Species Human (GRCh38)
Location X:132361993-132362015
Sequence TTGTTCCAGTGTAAGTCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197994844_1197994850 25 Left 1197994844 X:132361993-132362015 CCCTAGGACTTACACTGGAACAA No data
Right 1197994850 X:132362041-132362063 ATTATTTCTACATGGATGCAAGG No data
1197994844_1197994852 29 Left 1197994844 X:132361993-132362015 CCCTAGGACTTACACTGGAACAA No data
Right 1197994852 X:132362045-132362067 TTTCTACATGGATGCAAGGGTGG No data
1197994844_1197994851 26 Left 1197994844 X:132361993-132362015 CCCTAGGACTTACACTGGAACAA No data
Right 1197994851 X:132362042-132362064 TTATTTCTACATGGATGCAAGGG No data
1197994844_1197994848 2 Left 1197994844 X:132361993-132362015 CCCTAGGACTTACACTGGAACAA No data
Right 1197994848 X:132362018-132362040 GGGAACAAGTATCTATTTTCTGG No data
1197994844_1197994849 17 Left 1197994844 X:132361993-132362015 CCCTAGGACTTACACTGGAACAA No data
Right 1197994849 X:132362033-132362055 TTTTCTGGATTATTTCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197994844 Original CRISPR TTGTTCCAGTGTAAGTCCTA GGG (reversed) Intergenic
No off target data available for this crispr