ID: 1197995349

View in Genome Browser
Species Human (GRCh38)
Location X:132366877-132366899
Sequence CTTTATTAGCAGCATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197995349_1197995351 -7 Left 1197995349 X:132366877-132366899 CCATCCTCATGCTGCTAATAAAG No data
Right 1197995351 X:132366893-132366915 AATAAAGACATACCTGAGACAGG 0: 1097
1: 3639
2: 7030
3: 10378
4: 10910
1197995349_1197995354 14 Left 1197995349 X:132366877-132366899 CCATCCTCATGCTGCTAATAAAG No data
Right 1197995354 X:132366914-132366936 GGGTAATTTATAAAAGAAAGAGG 0: 235
1: 3991
2: 10443
3: 10552
4: 7015
1197995349_1197995352 -6 Left 1197995349 X:132366877-132366899 CCATCCTCATGCTGCTAATAAAG No data
Right 1197995352 X:132366894-132366916 ATAAAGACATACCTGAGACAGGG 0: 52
1: 2982
2: 6336
3: 10592
4: 11380
1197995349_1197995355 22 Left 1197995349 X:132366877-132366899 CCATCCTCATGCTGCTAATAAAG No data
Right 1197995355 X:132366922-132366944 TATAAAAGAAAGAGGTTTAAAGG 0: 87
1: 1624
2: 2286
3: 1833
4: 1922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197995349 Original CRISPR CTTTATTAGCAGCATGAGGA TGG (reversed) Intergenic
No off target data available for this crispr