ID: 1197995351

View in Genome Browser
Species Human (GRCh38)
Location X:132366893-132366915
Sequence AATAAAGACATACCTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33054
Summary {0: 1097, 1: 3639, 2: 7030, 3: 10378, 4: 10910}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197995349_1197995351 -7 Left 1197995349 X:132366877-132366899 CCATCCTCATGCTGCTAATAAAG No data
Right 1197995351 X:132366893-132366915 AATAAAGACATACCTGAGACAGG 0: 1097
1: 3639
2: 7030
3: 10378
4: 10910

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197995351 Original CRISPR AATAAAGACATACCTGAGAC AGG Intergenic
Too many off-targets to display for this crispr