ID: 1197995352

View in Genome Browser
Species Human (GRCh38)
Location X:132366894-132366916
Sequence ATAAAGACATACCTGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31342
Summary {0: 52, 1: 2982, 2: 6336, 3: 10592, 4: 11380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197995350_1197995352 -10 Left 1197995350 X:132366881-132366903 CCTCATGCTGCTAATAAAGACAT No data
Right 1197995352 X:132366894-132366916 ATAAAGACATACCTGAGACAGGG 0: 52
1: 2982
2: 6336
3: 10592
4: 11380
1197995349_1197995352 -6 Left 1197995349 X:132366877-132366899 CCATCCTCATGCTGCTAATAAAG No data
Right 1197995352 X:132366894-132366916 ATAAAGACATACCTGAGACAGGG 0: 52
1: 2982
2: 6336
3: 10592
4: 11380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197995352 Original CRISPR ATAAAGACATACCTGAGACA GGG Intergenic
Too many off-targets to display for this crispr