ID: 1197995354

View in Genome Browser
Species Human (GRCh38)
Location X:132366914-132366936
Sequence GGGTAATTTATAAAAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 32236
Summary {0: 235, 1: 3991, 2: 10443, 3: 10552, 4: 7015}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197995350_1197995354 10 Left 1197995350 X:132366881-132366903 CCTCATGCTGCTAATAAAGACAT No data
Right 1197995354 X:132366914-132366936 GGGTAATTTATAAAAGAAAGAGG 0: 235
1: 3991
2: 10443
3: 10552
4: 7015
1197995349_1197995354 14 Left 1197995349 X:132366877-132366899 CCATCCTCATGCTGCTAATAAAG No data
Right 1197995354 X:132366914-132366936 GGGTAATTTATAAAAGAAAGAGG 0: 235
1: 3991
2: 10443
3: 10552
4: 7015

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197995354 Original CRISPR GGGTAATTTATAAAAGAAAG AGG Intergenic
Too many off-targets to display for this crispr