ID: 1197995355

View in Genome Browser
Species Human (GRCh38)
Location X:132366922-132366944
Sequence TATAAAAGAAAGAGGTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7752
Summary {0: 87, 1: 1624, 2: 2286, 3: 1833, 4: 1922}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197995353_1197995355 -6 Left 1197995353 X:132366905-132366927 CCTGAGACAGGGTAATTTATAAA 0: 130
1: 6771
2: 13475
3: 14283
4: 11045
Right 1197995355 X:132366922-132366944 TATAAAAGAAAGAGGTTTAAAGG 0: 87
1: 1624
2: 2286
3: 1833
4: 1922
1197995349_1197995355 22 Left 1197995349 X:132366877-132366899 CCATCCTCATGCTGCTAATAAAG No data
Right 1197995355 X:132366922-132366944 TATAAAAGAAAGAGGTTTAAAGG 0: 87
1: 1624
2: 2286
3: 1833
4: 1922
1197995350_1197995355 18 Left 1197995350 X:132366881-132366903 CCTCATGCTGCTAATAAAGACAT No data
Right 1197995355 X:132366922-132366944 TATAAAAGAAAGAGGTTTAAAGG 0: 87
1: 1624
2: 2286
3: 1833
4: 1922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197995355 Original CRISPR TATAAAAGAAAGAGGTTTAA AGG Intergenic
Too many off-targets to display for this crispr