ID: 1197997395

View in Genome Browser
Species Human (GRCh38)
Location X:132392739-132392761
Sequence ATGGTGAAGAGGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1450
Summary {0: 1, 1: 0, 2: 8, 3: 146, 4: 1295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197997395_1197997398 -10 Left 1197997395 X:132392739-132392761 CCTTCCTCTTTCCTCTTCACCAT 0: 1
1: 0
2: 8
3: 146
4: 1295
Right 1197997398 X:132392752-132392774 TCTTCACCATCAATACTGCTTGG 0: 1
1: 0
2: 0
3: 14
4: 200
1197997395_1197997400 -2 Left 1197997395 X:132392739-132392761 CCTTCCTCTTTCCTCTTCACCAT 0: 1
1: 0
2: 8
3: 146
4: 1295
Right 1197997400 X:132392760-132392782 ATCAATACTGCTTGGCTGTAAGG 0: 1
1: 0
2: 1
3: 13
4: 127
1197997395_1197997401 17 Left 1197997395 X:132392739-132392761 CCTTCCTCTTTCCTCTTCACCAT 0: 1
1: 0
2: 8
3: 146
4: 1295
Right 1197997401 X:132392779-132392801 AAGGCTGCCTGTCCTACCACAGG 0: 1
1: 0
2: 2
3: 26
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197997395 Original CRISPR ATGGTGAAGAGGAAAGAGGA AGG (reversed) Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
901161859 1:7183638-7183660 ACTGTGAAAAAGAAAGAGGATGG + Intronic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901325598 1:8363460-8363482 AAGGGGCAGAGGAAAGTGGATGG + Intronic
901733342 1:11296266-11296288 CTGGTGAAGTGGAAAGAGTTTGG + Intergenic
902231266 1:15029193-15029215 ATGGTGAGGAGGAGGGTGGATGG + Intronic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902451874 1:16501413-16501435 ACGGTGTAGAGGAAAGAGCATGG - Intergenic
902501078 1:16912251-16912273 ATGGTAGAGAGGAAAGAGCATGG + Intronic
903155944 1:21443022-21443044 ATGGTGCAGAAGGAAAAGGATGG - Intronic
903571143 1:24306380-24306402 ATGGGGAAGAGAAAGAAGGATGG + Intergenic
904228790 1:29048682-29048704 ATGGTGAAGAGTAAAAAGCATGG - Intronic
904526306 1:31136395-31136417 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
904586617 1:31584339-31584361 AAGGTGCAGAGGAAAGAGGCAGG + Intronic
904807272 1:33140861-33140883 AAGGAGAAGGGGAGAGAGGAGGG - Intergenic
904927836 1:34062538-34062560 GTGGTGAAGAGGGCAGAGGGAGG + Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905043496 1:34978616-34978638 ATGGAGAACAGAATAGAGGAAGG - Intergenic
905270662 1:36785483-36785505 ATGCTGATGAGGAGGGAGGAGGG + Intergenic
905274148 1:36806244-36806266 CTGGTGAAGAACAACGAGGAGGG - Exonic
906028162 1:42693139-42693161 ATGCTCTAGAGGTAAGAGGAGGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906268755 1:44457141-44457163 AGGAGGAAGAGGAGAGAGGAAGG - Intronic
906598474 1:47102922-47102944 AAGGTGAAGAGGAAACAAAAGGG - Intronic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
906794804 1:48688352-48688374 ATGGAGATGAGGAAGCAGGAAGG - Intronic
906954180 1:50358854-50358876 ATGGAGAGGAGGGAAGAGCAGGG + Intergenic
906958408 1:50397160-50397182 CTGGTGTTGAAGAAAGAGGAAGG - Intergenic
907112129 1:51935791-51935813 AAGGGGAAGAGAACAGAGGAAGG + Intronic
907308204 1:53525282-53525304 ATGGGGAGGAGGAGAGGGGAAGG + Intronic
907378793 1:54067545-54067567 AAGGAAAAGAGGAAAGGGGAAGG - Intronic
907418044 1:54328033-54328055 ATGGTTGATAGGGAAGAGGACGG + Intronic
907645137 1:56234893-56234915 ATGGTGAAGTAAAAAGAGCACGG - Intergenic
907699620 1:56772368-56772390 ATTGTTAAGAGGAAAAAAGAAGG + Intronic
908066992 1:60416730-60416752 CTGGTAATGAGGAAAGAGAAGGG + Intergenic
908420768 1:63956354-63956376 AAGCTGAAGAGGAAAGTGGATGG + Intronic
908480716 1:64536332-64536354 ATTGTGTAGTGGAAAGAGCATGG - Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908825655 1:68130525-68130547 AAGGTGAATAGGAGAGAGGTTGG - Intronic
908937299 1:69391483-69391505 ATGGTGAATAGGAATGGTGAGGG + Intergenic
909882581 1:80898719-80898741 ATGAGAAAAAGGAAAGAGGAGGG - Intergenic
909899942 1:81120709-81120731 AATGGGAAGAGGAAAGAGCATGG - Intergenic
910107880 1:83651246-83651268 GTGATGGAGAGGAATGAGGAAGG + Intergenic
910211693 1:84800251-84800273 ATGGAGCAGAGGAAGGGGGAAGG + Intergenic
910217180 1:84854268-84854290 CAGGTGGAGAGGAAAGGGGAAGG - Intronic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
911171974 1:94779934-94779956 ATGTTGAAAGGGAGAGAGGAGGG - Intergenic
911452594 1:98083884-98083906 AGGGGGAAGACGGAAGAGGAAGG - Intergenic
911620921 1:100065732-100065754 AAGGGGAAGAGAAAAGGGGAAGG - Intronic
911665255 1:100543964-100543986 ATGGTGAGGAGGGAGTAGGATGG + Intergenic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
911801494 1:102144759-102144781 AGGGTGGAGAGGGAAGAGCAGGG - Intergenic
912041469 1:105396691-105396713 ATGGGGAATTGGAAAGGGGATGG + Intergenic
912226572 1:107741020-107741042 ATGAAAAAGAGGAGAGAGGAGGG + Intronic
912512217 1:110197367-110197389 ATGGTGATGGGGGAAGAGGGAGG + Intronic
912572991 1:110638103-110638125 ATGCCGAAGAGGAGAGGGGAGGG - Intergenic
913185210 1:116364472-116364494 ATGGTGCAGTGGAAAGAGAAGGG + Intergenic
913273762 1:117118671-117118693 AGGGTGAACAGGACACAGGATGG + Exonic
913428098 1:118757245-118757267 ATAGTTATGAGGAAACAGGATGG + Intergenic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914956987 1:152171789-152171811 GTTGTTAAGAGCAAAGAGGAGGG + Intergenic
914960105 1:152197504-152197526 AGGGGGAAGGGGAAAAAGGAAGG - Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915106271 1:153536737-153536759 ATGGTGAAGAGGGAGGGGGCTGG + Intergenic
915120683 1:153628205-153628227 ATGGTGCAGGGGAAAGAGGTGGG - Intronic
915447661 1:155983311-155983333 ATGGGAAGGAAGAAAGAGGAAGG + Intronic
915454419 1:156030057-156030079 ATAATGAAGAAGAAAGAGAATGG + Intergenic
915460998 1:156070600-156070622 ATGGTGGGGAGGACAGAGGAAGG - Intergenic
915463279 1:156082055-156082077 AGGGAAAAGAGGAGAGAGGAGGG + Intergenic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
916005427 1:160655065-160655087 ATGGAGAAGAGGCAAGTGGATGG - Intergenic
916275394 1:162988370-162988392 AGGGTGAAGAAGGAAAAGGAGGG + Intergenic
916339301 1:163710914-163710936 AAGGGGAAGAGGAAAGGGAAGGG - Intergenic
916339310 1:163710938-163710960 AAGGGGAAGAGGAAAGGGAAGGG - Intergenic
916503602 1:165408005-165408027 GTGGGGAAGATGAAAGATGACGG - Intronic
916878104 1:168992061-168992083 ATAGTAAATAGTAAAGAGGAGGG + Intergenic
917211022 1:172632100-172632122 ATGGGGAACTGGAAAGGGGATGG - Intergenic
917455210 1:175180157-175180179 ATGGTGAAGGGCACAGAGCAGGG - Intronic
917503220 1:175604633-175604655 AAGGAGAGGAGGAGAGAGGATGG - Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917651332 1:177080738-177080760 GTAGTGAAGGGGAAAGAGAATGG + Intronic
917656026 1:177126530-177126552 ATGGAAAACAGGAAAAAGGAAGG + Intronic
917657294 1:177138970-177138992 ATGGCGGAGTGGAAAGAGCATGG - Intronic
917670845 1:177272005-177272027 ATGGTGAATATGAAAGTGTAAGG - Intronic
918069503 1:181124556-181124578 AGGAGGAAGAGGAACGAGGAAGG - Intergenic
918102049 1:181384926-181384948 TTGGTAAAGAGGAAAGAGGCAGG - Intergenic
918102143 1:181385743-181385765 GAGGAGAGGAGGAAAGAGGAAGG - Intergenic
918149953 1:181789817-181789839 ATGGTGGTGAGAAAAGAGGATGG - Intronic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919026105 1:192172388-192172410 ATGGTGAAGACCAAAGAAGTGGG - Intronic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919275119 1:195404075-195404097 ATGGTGAGGAGGAAATATGTTGG + Intergenic
919457952 1:197842214-197842236 ATGTGGAGGAGGGAAGAGGAAGG + Intergenic
919469821 1:197964367-197964389 AGGCTGAAGTGGAAGGAGGATGG + Intergenic
919925079 1:202187985-202188007 AGAGTGCAGAGGACAGAGGAAGG + Intergenic
920081168 1:203373803-203373825 GTGGTGAAGAGGAAGGAGAGTGG - Intergenic
920188116 1:204174855-204174877 ATGGTGAAGATGAAAAAGATTGG + Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920255614 1:204652225-204652247 AGGGCGAAGGGGAGAGAGGAGGG - Intronic
920344029 1:205294414-205294436 ATGGTGAGGAGGATGGAGGCAGG + Intergenic
920373080 1:205491994-205492016 ATGGGGAAGAGGAAAGACTGGGG - Intergenic
920442921 1:205993389-205993411 ATGTTGAAGAGGGAAAAGGAGGG + Intronic
920791553 1:209097642-209097664 AGGCAGAAGAGAAAAGAGGAAGG - Intergenic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
921749978 1:218780939-218780961 ATGGTTCAGAGGAAAGCTGATGG + Intergenic
922724386 1:227915656-227915678 AAGGAGACGAGGGAAGAGGAAGG - Intergenic
922787285 1:228289287-228289309 ATTGTGAGGAGGAGAGAGGCAGG + Intronic
923081852 1:230665187-230665209 ATGGTGCAGTGGAAAGAGCATGG + Intronic
923127764 1:231047329-231047351 AGGAGGAAGGGGAAAGAGGAGGG - Intergenic
923362070 1:233221633-233221655 ATGGGGAAGAGAACAGAGCAAGG + Intronic
923373306 1:233334239-233334261 AGGCTGAGGAGGAAAGATGATGG - Intronic
923426342 1:233873432-233873454 ATGGTGAAAGGGGAAGAGCAAGG + Intergenic
923551865 1:234970575-234970597 AGGGTGGAGAGGGAAAAGGAGGG - Intergenic
923576314 1:235161904-235161926 TTGCAGAAGGGGAAAGAGGAGGG - Intronic
923589449 1:235306083-235306105 ATGATGACCAGGAAAGAGGCTGG + Intronic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
924096937 1:240561950-240561972 AAGGTGAAAAGGAAAGAGTATGG - Intronic
924247653 1:242100518-242100540 ATGGAGATGAGGAAACAGGACGG - Intronic
924262902 1:242250392-242250414 AAGGTGAAGGGGAATGGGGAAGG + Intronic
924628755 1:245717119-245717141 AGGGAGGAGAGAAAAGAGGAGGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1064269326 10:13850741-13850763 ATGGTGCAGTGAAAAGAGAATGG + Intronic
1064477646 10:15707997-15708019 AAGGTCAAGAGGACAGAGAATGG - Intronic
1064600178 10:16985398-16985420 ATGGGGAACTGGAAAGGGGATGG - Intronic
1064622290 10:17228850-17228872 AGCGGGAAGAGGAAAGAGTAAGG - Intronic
1065428161 10:25627345-25627367 AGGGTGGGGTGGAAAGAGGATGG - Intergenic
1065520321 10:26565796-26565818 ATGGGGAAGAGGAGAGAGTTGGG + Intronic
1065866449 10:29919189-29919211 AGGAAGAAGAGGAGAGAGGAGGG - Intergenic
1065866561 10:29919860-29919882 AAAGAGAAGAGGAAAGAGAAGGG - Intergenic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066277659 10:33884722-33884744 ATGGAGAAGAGAGAAGTGGATGG - Intergenic
1066334509 10:34462859-34462881 AAAGGGAAGAGGAAAGAGAAGGG + Intronic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1066721884 10:38348062-38348084 AAGGTGAAGGGGAATGGGGAAGG - Intergenic
1067174478 10:43933941-43933963 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1067554304 10:47257470-47257492 ATGGTGGAGATGCCAGAGGAGGG + Intergenic
1067744323 10:48923992-48924014 ATGGTGATGAGGAAGCAGCACGG + Intronic
1068217203 10:53998121-53998143 ATGGGCAAGAGAAAAGAGCATGG - Intronic
1068291814 10:55012790-55012812 ATTCTGAAGAGGAAAGATAAAGG - Intronic
1068752305 10:60609050-60609072 TTGAAGAAAAGGAAAGAGGAAGG + Intronic
1069635984 10:69925194-69925216 AGGCTGGAGGGGAAAGAGGAAGG + Intronic
1069670238 10:70196331-70196353 ATTATGAAAAGGAAAGAGGATGG - Intergenic
1069861880 10:71476562-71476584 TTGGCCAAGAGGACAGAGGATGG + Intronic
1070346104 10:75543471-75543493 GTGGGGAGGAGGAGAGAGGAAGG + Intronic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071388643 10:85147611-85147633 ATGCAGAAAAGGAAAGAGAAAGG - Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071988396 10:91075567-91075589 TTGGACAAGAGGAAAGAGAAGGG + Intergenic
1072009147 10:91288286-91288308 AAGGTAAAGAGGGAAGAAGAGGG - Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072632470 10:97155754-97155776 AAGGTTAAGAGGACATAGGAGGG + Intronic
1072783733 10:98267012-98267034 AAGGTGGAAGGGAAAGAGGAGGG + Intronic
1073267923 10:102239758-102239780 ATGCTGAAGAGGACAGAACAGGG - Intronic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073388831 10:103154487-103154509 ATGGTGTAATGGAAAGAGAATGG + Intronic
1073483370 10:103800990-103801012 GTGGTGAAGAGGCGGGAGGATGG - Intronic
1073565045 10:104527878-104527900 AGGGCAGAGAGGAAAGAGGATGG - Intergenic
1073671178 10:105591808-105591830 AGGGTGAGGAGGAAGGAGGAGGG + Intergenic
1073735076 10:106336273-106336295 ATGGTGAGCTGGAAAGGGGATGG - Intergenic
1073973302 10:109069841-109069863 ATGGTGGAGAGAAAAGAAAATGG + Intergenic
1073985188 10:109200154-109200176 AAAGTGAAGAACAAAGAGGAAGG + Intergenic
1074111999 10:110429332-110429354 GTGGTGAAGATGAAAGAAAAAGG - Intergenic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074148468 10:110738141-110738163 GTGCTGAAGAGGAAAGAGGCAGG + Intronic
1074428312 10:113371475-113371497 ATTGTGAAGAAGAAAGAATAGGG - Intergenic
1074679770 10:115893371-115893393 ATGATGCAGAGGAAAGAGCAAGG + Intronic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075259576 10:120950758-120950780 ATAGTGAAGAACAAAGAAGAGGG - Intergenic
1075838605 10:125477672-125477694 AGGGAGAGGAGGAAAGAAGAAGG + Intergenic
1075954446 10:126510036-126510058 ATGGAGCAGAGGACAGAGGGAGG - Intronic
1076069155 10:127472255-127472277 ATGGTGCAGGGGAGAGAGAAGGG + Intergenic
1076150892 10:128161252-128161274 CTGCAGAAGAGTAAAGAGGAAGG - Intergenic
1076318886 10:129564230-129564252 AGGGGGAAGGGGGAAGAGGAGGG - Intronic
1077190533 11:1254325-1254347 ATGGTGCATGGGAAGGAGGAGGG + Exonic
1077232023 11:1462009-1462031 AAGGTGAAGGGGTAGGAGGAGGG + Intronic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077701121 11:4443520-4443542 AGGGTGGAGAGGGAAGGGGAGGG + Intergenic
1077701129 11:4443539-4443561 AGGGTGGAGAGGGAAGGGGAGGG + Intergenic
1077701137 11:4443558-4443580 AGGGTGGAGAGGGAAGGGGAGGG + Intergenic
1077743693 11:4876937-4876959 ATAGTGCAAAGGAAAGCGGATGG - Intronic
1077747710 11:4925604-4925626 ATGGTGAAAAGGAAAGATGGGGG + Intronic
1077792075 11:5451760-5451782 AGGTTGGAGAGGAAAGAGAAAGG + Intronic
1077999390 11:7481378-7481400 AAGGTGAATAGGAAAAAGGTAGG - Intergenic
1078105254 11:8354308-8354330 AGGATGAGGAGGAATGAGGAAGG - Intergenic
1078263992 11:9739341-9739363 GTGGTTCAGAGAAAAGAGGAAGG + Intronic
1078391694 11:10940488-10940510 ATGGGAAAGTGGAAAGGGGAGGG - Intergenic
1078475955 11:11630351-11630373 AGTGGGAAGAGGCAAGAGGAAGG - Intergenic
1078604392 11:12762242-12762264 ATGGTGGAGAGGAAGAAGGTGGG + Intronic
1078658484 11:13264399-13264421 ATGGAGAAGAGAAAACAGTAGGG + Intergenic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1079279748 11:19076563-19076585 ATAGGGATGAGGAAAGTGGATGG + Intergenic
1079387319 11:19992084-19992106 TAGGAGAAGAGGAAAGGGGATGG - Intronic
1079431827 11:20397486-20397508 TTGAGGAAGAGGAAAGGGGAGGG - Intronic
1079605683 11:22363124-22363146 CTGATGAAGAGGAAAGAGTTAGG + Intronic
1079660910 11:23035552-23035574 AAGGGGAGGTGGAAAGAGGATGG - Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1080593179 11:33741959-33741981 ATGATGAAGAGGAGAGACGGAGG - Exonic
1080723830 11:34875094-34875116 ATGGGGAGCTGGAAAGAGGATGG - Intronic
1080765962 11:35296957-35296979 ATGGTGAATAAGACAGAGAAAGG - Intronic
1081041813 11:38223087-38223109 TTGGGGAAGAAGAAAGAGAAAGG + Intergenic
1081395910 11:42586058-42586080 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1081443590 11:43107524-43107546 AGGCTGCAGAGAAAAGAGGATGG - Intergenic
1081526017 11:43928297-43928319 ATGGTGAAAAGAAAAGATGTCGG + Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1082223082 11:49666040-49666062 AGGGTTATGAGGAAAGAGAAAGG - Intergenic
1082671779 11:56043675-56043697 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083588549 11:63878254-63878276 ATGGAGATGAGGAATGAGGCTGG - Intronic
1083700043 11:64470260-64470282 ATGGTCAAGAGTAAAGAGGCTGG + Intergenic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1084163792 11:67365644-67365666 AGGGTGATGGGGAAGGAGGAGGG + Intronic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084297088 11:68219622-68219644 AAGAAGAAGAGGAGAGAGGAAGG - Intergenic
1084368879 11:68724626-68724648 CTGGGGAAGAGAAAACAGGAGGG - Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1085187009 11:74584097-74584119 ATGACGAAGAAGACAGAGGAGGG + Intronic
1085224846 11:74910567-74910589 AAAGTGAAGAGAAAGGAGGATGG + Intronic
1085235159 11:75008974-75008996 AGGGGGAAGAAGTAAGAGGAGGG - Exonic
1085413623 11:76306279-76306301 AAGGTGAGGAAGACAGAGGAGGG - Intergenic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1085824218 11:79826154-79826176 AAGATGAAGAGGAAAGTGGCTGG - Intergenic
1085858348 11:80202171-80202193 ATTGTGAAGAAGAAATATGAAGG + Intergenic
1086482531 11:87258358-87258380 ATGTATAAGAGGAAAGAGGCTGG - Intronic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1086881002 11:92153118-92153140 ATGGGGAAGGTGAAAGAAGAAGG - Intergenic
1087062423 11:93993255-93993277 ATGGCGAACAGGGAAAAGGAGGG - Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087528778 11:99352769-99352791 GTGTTGAAAAGGGAAGAGGAAGG + Intronic
1087850825 11:103027519-103027541 ATGGCACAGAGGAAACAGGAAGG + Intergenic
1087875287 11:103348444-103348466 ATAGGGCAGAAGAAAGAGGAGGG - Intronic
1088222885 11:107588676-107588698 ATGGTGAAAAGGTGAGAGGGTGG + Intergenic
1088820639 11:113453791-113453813 AAGGTGCAGAGGAATAAGGAGGG - Intronic
1088827196 11:113506039-113506061 GTGGTGAAGCTGAAAGAGGCTGG - Intergenic
1089030262 11:115319376-115319398 ATGGTGAAGCAGAAAAAAGAAGG + Intronic
1089368191 11:117933935-117933957 TGGATAAAGAGGAAAGAGGAGGG + Intergenic
1089375798 11:117993727-117993749 GTGGTGGAGAGGAGAGAGGGTGG - Intronic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089453651 11:118613329-118613351 ATGGTGAAGAGGAGAATGAAAGG + Exonic
1089553582 11:119301149-119301171 CAGGTGAAGAGGAAAAGGGAAGG - Exonic
1089624765 11:119744296-119744318 GTGATGAAGAAGAAAGGGGATGG - Intergenic
1089629142 11:119773035-119773057 CAGGGGAAGTGGAAAGAGGAGGG - Intergenic
1089793609 11:120962519-120962541 TTCGTGAAGAGCACAGAGGAGGG + Exonic
1090234393 11:125136561-125136583 AGGAGGAAGAGGATAGAGGAAGG - Intergenic
1090236266 11:125150033-125150055 ATGTTGAAGAGATAGGAGGAGGG - Intergenic
1090311978 11:125749064-125749086 AAGCAGCAGAGGAAAGAGGAAGG - Exonic
1090554599 11:127860595-127860617 AATGTGAAGAGGAAATAGGTAGG + Intergenic
1091337223 11:134781514-134781536 GTGGAAAAGAGGAAAGAAGAGGG - Intergenic
1091446363 12:546136-546158 GTCGGGAAGAGGGAAGAGGAGGG + Intronic
1091469208 12:712176-712198 GGGATGGAGAGGAAAGAGGAGGG + Intergenic
1091470287 12:720567-720589 ATGGTGGAGGGCAAAGGGGAAGG + Intergenic
1091754686 12:3043742-3043764 AGAGTGAACAGGAGAGAGGAGGG + Intergenic
1092055045 12:5501808-5501830 ATGTGGAAGGCGAAAGAGGAAGG + Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092527741 12:9319496-9319518 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1092944734 12:13442176-13442198 AGGGAGAAGTGGAAAGAGAAGGG - Intergenic
1092969546 12:13678982-13679004 AGGAAGAAAAGGAAAGAGGAAGG + Intronic
1092969551 12:13679017-13679039 AGGAAGAAAAGGAAAGAGGAAGG + Intronic
1093001109 12:13997119-13997141 ATGGCTAAGTGGAAATAGGAAGG + Intergenic
1093034958 12:14324245-14324267 TTGGTGAATGGGAAATAGGACGG - Intergenic
1093092466 12:14937080-14937102 ATGGGGAAGGGGCAAGAGCATGG - Intronic
1093119058 12:15245325-15245347 ATGGTGACGAGGAAATTGGCTGG - Intronic
1093230864 12:16540211-16540233 AGGGTGGAGAAGGAAGAGGAAGG - Intronic
1093593309 12:20932224-20932246 ATGGTAAAGAGAATGGAGGAAGG - Intergenic
1093749237 12:22779559-22779581 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1093751791 12:22808083-22808105 ATGGGGAACTGGAAACAGGATGG + Intergenic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094136245 12:27129932-27129954 ATGGTGAAGGGAAAAGCAGATGG + Intergenic
1094185860 12:27642001-27642023 ATGGTGAAGGGAAAAGTAGATGG + Intronic
1094355492 12:29573501-29573523 AGGGTGAAGAAGTAGGAGGAGGG + Intronic
1094441882 12:30486718-30486740 TTGGTGAAGTGGAAACAGAATGG - Intergenic
1094499988 12:31012543-31012565 AAGTTGAAGAGGAAGGAGGACGG - Intergenic
1094583105 12:31752421-31752443 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1095862182 12:46929870-46929892 ATGGCGAACAGTAAAGAAGATGG - Intergenic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096007174 12:48183124-48183146 ACGGTGCAGAGGCAGGAGGAGGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096535980 12:52274967-52274989 TTGGTGGAGAGCAAAGAGCATGG + Intronic
1096665366 12:53160658-53160680 ATGGTAAAGAGAATAGAGAAAGG + Intronic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097504052 12:60441965-60441987 ATGTTGAAGAGGAGAGGTGAGGG - Intergenic
1098167785 12:67715812-67715834 ATGGCAAAGAGGGAAGAGGGAGG + Intergenic
1098342272 12:69464635-69464657 ATTCTGCATAGGAAAGAGGAAGG + Intergenic
1099051401 12:77785465-77785487 AAGGTGAAGAAGTAGGAGGAGGG + Intergenic
1099528944 12:83751662-83751684 ATGATGAATAGGATAGAGGATGG - Intergenic
1099578151 12:84406024-84406046 ATGGTGAAGAGATATGTGGATGG + Intergenic
1099611005 12:84869670-84869692 AAGTTGAATTGGAAAGAGGAAGG - Intronic
1099938998 12:89162617-89162639 AAAGTGAAGAGTAAAAAGGATGG + Intergenic
1099943665 12:89220207-89220229 GGGGTGAGGAGGAAAAAGGAGGG - Intergenic
1099988649 12:89699069-89699091 ATGGTGAAGAGGGGACAGGGGGG - Intronic
1100097484 12:91059477-91059499 ATGGTGAAGAGGAAATAGATTGG - Intergenic
1100214404 12:92432958-92432980 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1100367871 12:93937957-93937979 AGGGTGAGCAGGAAAGAGCAGGG - Intergenic
1100690288 12:97032264-97032286 ATGGTAAAGTGGGAAGAGAAAGG + Intergenic
1100728898 12:97441756-97441778 ATGGAGGAGAGGAGAGAGGGAGG + Intergenic
1100900633 12:99236697-99236719 ATGTTGAATAGGAATAAGGAGGG + Intronic
1100947915 12:99808047-99808069 ATGGTATAGTGGAAAGAGCATGG - Intronic
1101037017 12:100716556-100716578 ATGAAGCAGGGGAAAGAGGAAGG - Intergenic
1101302883 12:103499516-103499538 ATGGAGAAGAGAAAGGAAGATGG + Intergenic
1101308843 12:103557711-103557733 ATGGGGAAGGGGAGACAGGATGG - Intergenic
1101469608 12:104984252-104984274 ATGGGGAATAGGAAAGGGGATGG + Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101847679 12:108375647-108375669 ATGGTGAAGAGCAAAGGGAGTGG + Intergenic
1101909973 12:108854023-108854045 AAGGAGAAGTGGAAAGAGCAGGG + Intronic
1102509442 12:113404092-113404114 AAGGGGAAGTGGAAAGAGGGAGG - Intronic
1102585271 12:113918576-113918598 CTGGTCTAGAGGACAGAGGATGG + Intronic
1102786115 12:115606343-115606365 AGGGGGAAGGGGAGAGAGGAGGG + Intergenic
1102810274 12:115818410-115818432 CTTGAGAAGAGGAGAGAGGAAGG - Intergenic
1102852820 12:116266274-116266296 AAGGAGGAGAGGAAAGAGAAGGG + Intronic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103005632 12:117418096-117418118 AAGGTAGAGAGGAAGGAGGAAGG + Intronic
1103072622 12:117957437-117957459 ATGGTGGCCAGGAAGGAGGATGG - Intronic
1103148915 12:118619966-118619988 ATGGTGAACTGAAAAGAAGATGG - Intergenic
1103321961 12:120097373-120097395 TCTGTGGAGAGGAAAGAGGAAGG + Exonic
1103377073 12:120465367-120465389 GTGGTGAGAAGGAAAGATGATGG - Intronic
1104041353 12:125133430-125133452 ACGGGGAAGAGGAAAGAGCCAGG - Intronic
1104510269 12:129371372-129371394 ATGGTGATGATGAATGATGATGG + Intronic
1104544506 12:129698743-129698765 AGGGGGAAGAGGAGAGGGGAGGG + Intronic
1104738944 12:131158589-131158611 ATAGAGAAGAGGAAGGAAGAAGG - Intergenic
1105073738 12:133255933-133255955 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1105278560 13:18950114-18950136 ATGGTGATGGGGACAGAGGTGGG - Intergenic
1105828333 13:24142647-24142669 ATGAGGAAGAGGAAAGGGGGAGG - Intronic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106362673 13:29046856-29046878 AAAGTGGAGAGGAAAGGGGAAGG - Intronic
1106505014 13:30363677-30363699 ATGGTGTAGGAGAAAAAGGATGG - Intergenic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1106882604 13:34148316-34148338 AGGGTGGAGTGGCAAGAGGATGG - Intergenic
1107021982 13:35761219-35761241 ATGGTTATGAGGACAGAAGATGG + Intergenic
1107120194 13:36787661-36787683 AATGTGAAGAGGAAACAGGAGGG + Intergenic
1107399188 13:40052182-40052204 AGGCTGAAGAGCAGAGAGGAAGG + Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1107679526 13:42833973-42833995 ATGTTAAGGAGGAAATAGGAAGG - Intergenic
1107736887 13:43408127-43408149 TTGGTGATGATGAAAGGGGAGGG + Intronic
1107756414 13:43628360-43628382 ATAGTGAAGGGGAGAAAGGAAGG - Intronic
1108026726 13:46185631-46185653 GTGGTGAAGAGTAAAGATGCTGG + Intronic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108443209 13:50477527-50477549 ATGGAAATGAGGAAAGGGGAAGG + Intronic
1108809208 13:54200646-54200668 ATGGCTAAAAGGAAAGAGGCAGG - Intergenic
1109155527 13:58905167-58905189 AAGGTGAAGAGGAAATAAAATGG - Intergenic
1109636462 13:65124452-65124474 AAGGGGAAGAGGAAACAGGAGGG - Intergenic
1109643752 13:65225392-65225414 ATCCTGAAGATCAAAGAGGAAGG + Intergenic
1109682878 13:65775529-65775551 ATGGTGGACAGGAAAGGAGATGG + Intergenic
1110328745 13:74247469-74247491 TAGGTGAAGAAGAAAGATGAAGG + Intergenic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110351867 13:74518187-74518209 ATGGTGATGAAGAAAGAAGGAGG - Intergenic
1110433900 13:75458209-75458231 ATGGGGAGCTGGAAAGAGGATGG + Intronic
1110441033 13:75525324-75525346 ACAGGGAAGGGGAAAGAGGAAGG + Intronic
1110455115 13:75682558-75682580 GGGGTAAAGAGGAAAGGGGAGGG + Intronic
1111204019 13:84980155-84980177 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG + Intergenic
1111400864 13:87733114-87733136 ATATTGAGGAGGAGAGAGGAGGG + Intergenic
1111547572 13:89762445-89762467 ATGATAAAGAGAAAAGAAGAAGG - Intergenic
1111725165 13:91998303-91998325 ATCTTGAAGAGCAAAGTGGAAGG - Intronic
1112118059 13:96379069-96379091 GTGGAGAAATGGAAAGAGGATGG - Intronic
1112204039 13:97306424-97306446 TTGAAGAAGAGGAAAGAAGATGG - Intronic
1112541014 13:100313130-100313152 AGGGAGGAAAGGAAAGAGGAAGG - Intronic
1112740282 13:102465457-102465479 ACTGTGAGGAGGAGAGAGGAAGG + Intergenic
1113055102 13:106259475-106259497 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1113073005 13:106439458-106439480 CTGGTGTAGAGGAAAGATGTGGG + Intergenic
1113089655 13:106603601-106603623 ATGGTGCAGAGCAGAGAGGCAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113613296 13:111663323-111663345 AAGGTGAGGAAGAAGGAGGAGGG - Intronic
1113920387 13:113904895-113904917 AAGGTGATAAAGAAAGAGGAAGG + Intergenic
1114050917 14:18919383-18919405 AGGGGGAGGAGGAAAGAGGGTGG - Intergenic
1114111642 14:19482539-19482561 AGGGGGAGGAGGAAAGAGGGTGG + Intergenic
1114320015 14:21539439-21539461 GTGGTGAAGTGGAGAGGGGAGGG + Intergenic
1114353515 14:21881427-21881449 AAGGAAAAAAGGAAAGAGGAGGG - Intergenic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114781291 14:25540955-25540977 ATGCTGAAAAGGAGTGAGGATGG + Intergenic
1115017552 14:28635262-28635284 AAGGGGCAGAGGAAAGAAGAAGG + Intergenic
1115261794 14:31461897-31461919 ATTCTGAAGGGGTAAGAGGAAGG + Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117299630 14:54412011-54412033 ATGGTGATGAGGGGAAAGGAGGG - Intronic
1117390357 14:55256544-55256566 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
1117797243 14:59407023-59407045 ATGGTGATGAATAAAAAGGAAGG + Intergenic
1118117940 14:62802603-62802625 TAAGTGAAAAGGAAAGAGGAAGG + Intronic
1118260208 14:64239271-64239293 ATGCTGATGAGGAAAGATGCGGG - Intronic
1118451872 14:65910370-65910392 ATGCTGCAGAGGAAAGAAAAAGG + Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118661769 14:68021617-68021639 AAGATGAAGAGTAAAGTGGAAGG - Intronic
1119357778 14:74021244-74021266 GAGGTGGAGAGGAAAAAGGATGG - Intronic
1119727652 14:76931605-76931627 ATGGTGAAGAGGAGACAGACAGG - Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119858189 14:77916715-77916737 ATAGTGAGGAAGAAAGAAGAGGG - Intronic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1119904273 14:78287222-78287244 ATTGTGAAGAGGAAGTAGAAGGG + Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1119977071 14:79037085-79037107 TCTGAGAAGAGGAAAGAGGAAGG + Intronic
1120401392 14:84036943-84036965 ATGCTCAAGAGGAAACAGAAAGG + Intergenic
1121415269 14:93774935-93774957 ATCACGAAGAGGAAAGAGCAGGG + Intronic
1121546688 14:94768519-94768541 CCGGAGAAGAGGGAAGAGGAAGG - Exonic
1121593306 14:95137315-95137337 AAGGGGAAGAGGAAAGGGAAAGG + Intronic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1121788155 14:96678405-96678427 ATGGTGGAAGGCAAAGAGGAAGG - Intergenic
1121798918 14:96757215-96757237 AGGGGGAAGAGGATGGAGGAGGG + Intergenic
1122156590 14:99753817-99753839 GTGGGGAAGAGAAAACAGGATGG - Intronic
1122589491 14:102837005-102837027 ATGAGGAGGAGGAAAGAGCAAGG - Intronic
1123539250 15:21271690-21271712 GTGGGGGAGAGGGAAGAGGAAGG - Intergenic
1123695793 15:22878236-22878258 ATGCTGAAGAAGAAGGAGCAAGG + Intronic
1124376717 15:29133243-29133265 TTGGTAAAGAGGAGAGAAGATGG - Intronic
1124654546 15:31497851-31497873 GTGGGGAAGAGGAAATGGGAAGG + Intronic
1125299937 15:38244678-38244700 ATGTTGCAGTGGGAAGAGGAGGG + Intergenic
1125413427 15:39428567-39428589 ATGGTGAAGTGGAATGATAATGG - Intergenic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1125897262 15:43313031-43313053 ATGGTGAAGAGGAAGAAGTTAGG + Intergenic
1126193443 15:45903541-45903563 AAGGAGAAGAGGAGAAAGGAAGG - Intergenic
1127713476 15:61624558-61624580 TGGGTGAAGAGGAATGATGAAGG + Intergenic
1127902067 15:63348327-63348349 ATGGTGACTAGGGAAGAGGGAGG + Intronic
1127902556 15:63351642-63351664 AAGGTGCAGAGGAAAGAAGAGGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128302010 15:66571868-66571890 GTGGTGAGGAGGAAAGGGGAAGG + Intergenic
1128336739 15:66791378-66791400 TTCTTGAAGAGGAAAGATGAGGG + Intergenic
1128356093 15:66927817-66927839 ATGGTACAGAGGAAAGGGGTTGG - Intergenic
1128485722 15:68085550-68085572 ATGGTTTAGTGGAAAGAGCATGG + Intronic
1128509855 15:68306725-68306747 ATGCTGGAGAGCAAAGAGGCGGG - Intronic
1128547962 15:68579985-68580007 AGAGTTAAGAGGAAAGATGATGG + Intronic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1128589952 15:68887160-68887182 AGGGTAAAGAGGAAAGAAAAGGG + Intronic
1128667736 15:69550836-69550858 AAGGTGGAGAGGAAGTAGGAGGG + Intergenic
1128795242 15:70461901-70461923 AGAGTGAAGAGGAAATGGGATGG + Intergenic
1128808455 15:70552475-70552497 ATGGTGAGGGGGCAAGAGCAGGG + Intergenic
1128867414 15:71125095-71125117 AAGGTGAAGAGGAAGGGGAAAGG + Intronic
1128941371 15:71790486-71790508 ATGAAGAACAGGCAAGAGGAAGG + Intergenic
1129039098 15:72670476-72670498 ATGGGGCAGAGGAAGGAGGCGGG + Intergenic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129119523 15:73387514-73387536 AGGGGGAAGAGCAAACAGGAGGG + Intergenic
1129399610 15:75274326-75274348 ATGGGGCAGAGGAAGGAGGCGGG + Intronic
1129415276 15:75373471-75373493 AGGCTGAAGAGGGAGGAGGAAGG - Intronic
1129681316 15:77659929-77659951 CTGGTGGAGAGGAAAGGGGCGGG + Intronic
1129715526 15:77846388-77846410 ATGGTGGAAGGCAAAGAGGAAGG - Intergenic
1129781014 15:78271220-78271242 GTGGTGGATAGAAAAGAGGAAGG + Intronic
1130225995 15:82058823-82058845 AGGGAGGAGAGGGAAGAGGAGGG - Intergenic
1130298070 15:82661103-82661125 ATTCTGCAGAAGAAAGAGGAGGG - Intronic
1130690286 15:86076347-86076369 ATGTTGAATAGGAAAGAGCAAGG + Intergenic
1130789481 15:87137544-87137566 ATGGAAAAGAGTAAAGAGGATGG + Intergenic
1130794422 15:87193794-87193816 AATGAGAAGAGGAAACAGGAAGG - Intergenic
1130807462 15:87341022-87341044 CAGGTAAAGAGGAAAGAGGTGGG + Intergenic
1130838102 15:87671679-87671701 ATGGTGATGAGGATGGAAGATGG - Intergenic
1130842411 15:87713350-87713372 ATCGTGGATAGGAAGGAGGATGG - Intergenic
1130847689 15:87762511-87762533 TTGGTGAAGATGAAAGGAGATGG + Intergenic
1131094732 15:89648188-89648210 GTGGTGGAGAGGAAGGAAGAGGG - Intronic
1131111012 15:89765566-89765588 AAGGGGAAGAGGAAAGGGAAGGG + Intronic
1131139816 15:89968077-89968099 ATGATGATGAAGAAAGAAGAGGG + Intergenic
1131474758 15:92728400-92728422 ATGGTGAATAGAAAAGGCGAGGG - Intronic
1131651929 15:94409714-94409736 ATGGAGAAGAGGGAAGAGAGAGG - Intronic
1131709515 15:95037817-95037839 ATGGGGAACTGGAAAGGGGATGG - Intergenic
1131821331 15:96277510-96277532 ATGTTGAACAGGATACAGGATGG - Intergenic
1131937771 15:97525742-97525764 ATGGAAAAAAGGAAAGAAGAAGG + Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133808772 16:9145267-9145289 ATGGGGAATTGGAAAGGGGATGG - Intergenic
1134111336 16:11517202-11517224 ATGGTTTCTAGGAAAGAGGAAGG - Intronic
1134295235 16:12939686-12939708 CAGGTGATGGGGAAAGAGGAAGG - Intronic
1134297570 16:12960772-12960794 TTGGAGAGGAGGGAAGAGGACGG - Intronic
1134317216 16:13129791-13129813 ATGGTAAATAGGAGAAAGGATGG - Intronic
1134814757 16:17196700-17196722 AGGGTGAAAAGGAAAGTGGATGG - Intronic
1134846279 16:17443509-17443531 ATGGTGGAAGGCAAAGAGGAAGG - Intronic
1134904840 16:17971506-17971528 AAGGGGAAGAGGAAAGAAGATGG + Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135168743 16:20164604-20164626 ATGGGGAGGAGGAGAGAAGAGGG - Intergenic
1135186082 16:20316982-20317004 AAGGGGAAGAGGAAAGGGAAAGG - Intronic
1135186103 16:20317050-20317072 AAGGGGAAGGGGAAAGAGAACGG - Intronic
1135460929 16:22642275-22642297 ATGGTGAACAAGAAAGATGCAGG - Intergenic
1136776200 16:32873108-32873130 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1136894415 16:33988404-33988426 ATGGACAAGAAGAAAGAGTAAGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137561902 16:49507999-49508021 GTGGTGAAGAGGACAGAAGCCGG + Intronic
1137688482 16:50403164-50403186 ATGGTGAGAAGGAGGGAGGAAGG + Intergenic
1137806781 16:51314023-51314045 ATGATGAACAGAAAAGAGGGAGG - Intergenic
1137867816 16:51919042-51919064 ATGGTGTAGTGGAAACAGTATGG - Intergenic
1138086081 16:54134986-54135008 GTACTCAAGAGGAAAGAGGAGGG - Intergenic
1138214070 16:55187643-55187665 TGTGTGAGGAGGAAAGAGGAAGG - Intergenic
1138242221 16:55436276-55436298 ATGGGCCAGAGGAGAGAGGAGGG + Intronic
1138439960 16:57028262-57028284 ATGGTGGGGAGGAACGAGGAGGG - Intronic
1138623660 16:58232002-58232024 ATGGTTATGAGGAATGAGGTTGG + Intronic
1139097729 16:63725823-63725845 ATGGTCAAGAGCAAAGATCATGG + Intergenic
1139392914 16:66616775-66616797 ATGGTGAGGAGGGGAGAGGAGGG - Exonic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140200615 16:72891759-72891781 GTGGTGAGGAGAAAAAAGGAAGG - Intronic
1140266878 16:73428643-73428665 ATGGTGGGGAGGGAGGAGGAAGG - Intergenic
1140271132 16:73467232-73467254 ATCTTGAAGAGGAGAGAGAATGG + Intergenic
1140894361 16:79311940-79311962 ATGGCGGAGAGGGAAGAGGAGGG + Intergenic
1141114433 16:81296312-81296334 ATGGAGAAGTGGAAAGACTAGGG - Intergenic
1141436940 16:84005177-84005199 ATGGGGAAGAGGAAAAGGGGAGG + Intergenic
1142023082 16:87796079-87796101 ATCATGCAGAGGACAGAGGAAGG + Intergenic
1142128477 16:88421596-88421618 CTGGGGCAGAGGAAAGGGGATGG + Intergenic
1203078615 16_KI270728v1_random:1135217-1135239 ATGGACAAGAAGAAAGAGTAAGG + Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142785773 17:2221389-2221411 ATGGTGGAAGGCAAAGAGGAAGG - Intronic
1143007862 17:3848497-3848519 ATCGCGAACAGGAAAGGGGATGG - Intergenic
1143064967 17:4240017-4240039 ATTGTAAAGAGAAAAGAGCAGGG - Intronic
1143114731 17:4576119-4576141 ATGATGAAGAGGAGAAGGGAGGG - Intergenic
1143213918 17:5209974-5209996 ATGGGGAACAGGAAAGAAAAGGG - Exonic
1143250066 17:5516814-5516836 ACAGTGTAGTGGAAAGAGGATGG - Intronic
1143260488 17:5594962-5594984 ATGATGATGAGCAGAGAGGATGG - Intronic
1143272408 17:5685525-5685547 ATGGTGAAGAGGAGGCTGGAGGG + Intergenic
1143280875 17:5753230-5753252 AGAGAAAAGAGGAAAGAGGAAGG - Intergenic
1143491350 17:7286891-7286913 AAGGTGGGGAGGAAAGGGGATGG - Exonic
1143734040 17:8897834-8897856 ATGGTGGAGTGGAAAGATGAGGG + Intronic
1143918858 17:10315026-10315048 ATAATGAAGAAGAAAGAGGAGGG + Intronic
1143953747 17:10653411-10653433 GTGGTGAAGGGGGAAGAGGTGGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1143986583 17:10919798-10919820 AAGGTCAAGAGGTAAGAGGCAGG + Intergenic
1144468706 17:15517828-15517850 ATGGTGCAGTGGGAAGAGAATGG - Intronic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1145193775 17:20869206-20869228 ATAATGAGGAGGAAAGAGGGTGG + Intronic
1145217994 17:21066575-21066597 GTGGTGCAGAGGAGAGAGGAGGG + Intergenic
1145293227 17:21566702-21566724 ATGCTGGAGGGGAAAGAGGAAGG + Intronic
1145351998 17:22091434-22091456 ATAATGAGGAGGAAAGAGGGTGG + Intergenic
1145386740 17:22419235-22419257 TTGCTGGAGGGGAAAGAGGAAGG - Intergenic
1145709585 17:26958841-26958863 AGGATGAAAAGTAAAGAGGAGGG - Intergenic
1145722699 17:27088539-27088561 ATGAGGAGGAGGAAAGAGGGTGG - Intergenic
1146024815 17:29310650-29310672 ATGGTGAAGATCAGAGAGAAAGG - Intergenic
1146505215 17:33399091-33399113 ATAGAGATGAGCAAAGAGGAAGG + Intronic
1146556789 17:33831826-33831848 ATCTTGAAGAGGAGAGAGGAGGG + Intronic
1147504840 17:41005686-41005708 TTGGTGTAGTGGAAAGAGAAGGG + Intergenic
1147549062 17:41425685-41425707 ATGATGAAGTGAAAAGAGAATGG - Intergenic
1147754180 17:42757355-42757377 AAGGGGAAGGGGAAAAAGGAAGG - Intergenic
1147773838 17:42886474-42886496 AGAAGGAAGAGGAAAGAGGAAGG - Intergenic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148299076 17:46530442-46530464 ATCTGGAATAGGAAAGAGGAGGG + Intronic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148494433 17:48044652-48044674 GTGGTGCATAGGAAAGAGGCTGG + Intergenic
1148566897 17:48638626-48638648 AGGACGAAGAGAAAAGAGGAGGG + Intergenic
1148645186 17:49216155-49216177 ATAGTAGAAAGGAAAGAGGAAGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149281578 17:55111080-55111102 ATAGTGAAGAGGAAGGAAAATGG + Intronic
1149470962 17:56914570-56914592 TCCGGGAAGAGGAAAGAGGAAGG - Intergenic
1149540891 17:57467361-57467383 AAAGGGAAGAGAAAAGAGGAAGG + Intronic
1149689170 17:58559514-58559536 TTGGTGAAGAGAAAAGAAAAAGG - Exonic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1150245423 17:63671108-63671130 CTGATGAAGTGGAGAGAGGAAGG + Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1150841667 17:68613302-68613324 ATAGGGAAGAGGAAGAAGGAAGG - Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151196726 17:72437083-72437105 AGGCTGGAGAGGAAAGAGAAGGG - Intergenic
1153427074 18:4976751-4976773 ATGGTGAAGAGGTCAGATGATGG - Intergenic
1153986750 18:10357553-10357575 ATGGTGAAGGGGAAGGAAGCAGG - Intergenic
1154350987 18:13583325-13583347 AAGGTGAGGTGGAGAGAGGATGG + Intronic
1155076683 18:22363444-22363466 ATGGTCCAGAGGAAAGATGATGG - Intergenic
1155281472 18:24245024-24245046 CTAGCGAAGAGGAAAGAGTAAGG - Intronic
1155385751 18:25275642-25275664 ATGGGGAGAAGGAAAGAGGGAGG - Intronic
1155531600 18:26772467-26772489 AAGGTGAAAATGAAAGATGAAGG - Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155683705 18:28520914-28520936 ATGGGGAGCTGGAAAGAGGATGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155995944 18:32331823-32331845 AAGGTGAAGGGGAAAGAGTGAGG + Intronic
1156177341 18:34562505-34562527 ATGGTAAAGAAAAAAAAGGAAGG - Intronic
1156189647 18:34703483-34703505 ATGGTGAACAATAAACAGGAAGG - Intronic
1156419494 18:36935306-36935328 AAGGAGAAGAGGAAAAAGGGAGG - Intronic
1156491374 18:37498403-37498425 GGGGAGAAGAGGGAAGAGGAGGG - Intronic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156608989 18:38703977-38703999 GTGGTTAAGTGGAAAGGGGATGG - Intergenic
1156740539 18:40322076-40322098 ATGGTGGAAGGGGAAGAGGAAGG - Intergenic
1156876466 18:42019913-42019935 CTGGTGGAGAGGAAGTAGGAAGG - Intronic
1156933907 18:42679337-42679359 ATGGTGAGGTGGCAAGAGTATGG - Intergenic
1156988585 18:43379110-43379132 ATGGTAAACAGGAATTAGGAAGG - Intergenic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157475337 18:48020482-48020504 AGGGTGGAGAGGGAAGATGATGG - Intergenic
1157671794 18:49536467-49536489 AGGCTGGAGAGGAAAGAGGGAGG - Intergenic
1159378285 18:67622711-67622733 ATGATATAGAGAAAAGAGGAAGG + Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1160110482 18:76024900-76024922 GTGGTGAAGAGGGCAGAGGGCGG - Intergenic
1160408354 18:78658642-78658664 GTGGTGGAGAGAAAGGAGGAGGG + Intergenic
1160676637 19:394670-394692 AGGATGATGAGGAAAGATGATGG + Intergenic
1160776358 19:858279-858301 ATGGTGAAGAGAAAAGCCGGGGG + Intergenic
1161803532 19:6429462-6429484 GAGGAGGAGAGGAAAGAGGAGGG + Intronic
1161918332 19:7247399-7247421 ATCGAGAAGAGGAACAAGGAAGG - Intronic
1161918737 19:7250346-7250368 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1161934545 19:7363608-7363630 ATGGATGAAAGGAAAGAGGATGG + Intronic
1162006599 19:7784469-7784491 ATGGTACAGAGGGAGGAGGAAGG - Intergenic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1163061267 19:14763904-14763926 AGGAAGAGGAGGAAAGAGGATGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163398165 19:17076047-17076069 ACGGTGAAGGAGAAAGTGGATGG + Intronic
1163640342 19:18458448-18458470 ACAGAGGAGAGGAAAGAGGATGG + Intronic
1163884648 19:19955107-19955129 AAGGAGAAGGGGAAAGAAGAAGG + Intergenic
1164441908 19:28285163-28285185 AGGATGGAGGGGAAAGAGGATGG + Intergenic
1164579834 19:29428046-29428068 GTGGTGGGGAGGATAGAGGAAGG - Intergenic
1164680544 19:30131170-30131192 AGGGGGAAGGGGAAAGAGGGAGG - Intergenic
1164912869 19:32026649-32026671 ATGGGCAACAGGAAAGAGCAAGG - Intergenic
1165422452 19:35728965-35728987 ATGCTGAAGAGGAAATGTGAAGG - Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166297608 19:41896692-41896714 AAGGAGCAGAGGAAAAAGGAAGG - Intronic
1166332954 19:42089241-42089263 AAGGAGGAGAGGAGAGAGGAAGG + Intronic
1166655406 19:44607631-44607653 AAAGTGGAGAGGAAAGGGGAAGG - Intergenic
1166736918 19:45091328-45091350 AGGCTGGAGAGAAAAGAGGAGGG - Exonic
1166911279 19:46160072-46160094 AAGGTGATAAGGAAGGAGGAAGG - Intronic
1166911343 19:46160481-46160503 ATGGGCAAGAGTGAAGAGGAAGG + Intronic
1166922776 19:46241935-46241957 AAGGTGATTAGGAAGGAGGAAGG - Intergenic
1167469213 19:49666092-49666114 GGGGTGAGGAGGGAAGAGGAGGG + Intronic
1167469788 19:49669207-49669229 ATGGTCAGGTGGAAAGAGGCTGG + Intronic
1167527690 19:49995139-49995161 AGGAAGAAGAGGAAAGAGGCCGG + Intronic
1167598218 19:50438375-50438397 ATGGTGGAGAGGTGGGAGGATGG + Intronic
1167608166 19:50492792-50492814 AAGAGGAGGAGGAAAGAGGAAGG + Intergenic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1167789379 19:51663615-51663637 GTGGTGAGGAGGAAAAAGAAAGG - Intergenic
1167821720 19:51934396-51934418 ATGGAGGAGAGGAAAGGGGGTGG - Intronic
1168423407 19:56219919-56219941 ATGGGGAGGAAGGAAGAGGAGGG + Exonic
1168484810 19:56752050-56752072 ATCGTGAAGAGAAAATGGGAAGG - Intergenic
1168543476 19:57231545-57231567 AAGGGGAAGAAGAAAGAGTAAGG - Intronic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
925488003 2:4357764-4357786 ATGGGGAGCAGGAAAGAGCAAGG - Intergenic
925796987 2:7556256-7556278 ATGGTGAAAAAGAAAAGGGAGGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
925882367 2:8363505-8363527 ATGGAGAAGAGGAAAACAGAAGG + Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926162920 2:10501165-10501187 AGGGTGAGCAGGAAAGTGGATGG - Intergenic
926702000 2:15810065-15810087 GAGGGCAAGAGGAAAGAGGAGGG - Intergenic
926772151 2:16387885-16387907 ATGGTGAAGATGAAATGAGAAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
926820651 2:16848101-16848123 ATGGTCAAGATGAAAGAGGTGGG + Intergenic
926893104 2:17655227-17655249 ATGATGAAAATGAATGAGGATGG + Exonic
927088113 2:19690320-19690342 GAGGTGGGGAGGAAAGAGGAGGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927416263 2:22883817-22883839 ATGGAAAAAAGGGAAGAGGAGGG + Intergenic
927513330 2:23658124-23658146 ATGGGGAGGAGGGTAGAGGAAGG - Intronic
927929823 2:27036924-27036946 ATGGTGAGGAAGGAAGAAGAGGG + Intronic
927936359 2:27078864-27078886 GAGCTGAGGAGGAAAGAGGAGGG + Exonic
928180324 2:29064115-29064137 AAGGAGGAGAGGACAGAGGACGG + Exonic
928330004 2:30350401-30350423 ATTCTGAGGAGGGAAGAGGAAGG + Intergenic
928600422 2:32898985-32899007 ATGGGGGAGAAGCAAGAGGAGGG - Intergenic
928655018 2:33441368-33441390 ATGCTGAAGAGAAAAGACCAAGG + Intronic
928803416 2:35122555-35122577 ATGGTGATGACTAAAGAGAAAGG - Intergenic
928960132 2:36915882-36915904 AAGGGGAAGAGGGAAAAGGAAGG + Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929207451 2:39313362-39313384 AGGGTGAAGAGTTAGGAGGAGGG - Intronic
929277525 2:40042316-40042338 AAGGGGAAGAGGAAAGGGAAGGG - Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
929362633 2:41112716-41112738 ATGGGGGGGATGAAAGAGGAAGG - Intergenic
929385709 2:41403722-41403744 AGGGAGAAAAGGAAAGGGGAAGG + Intergenic
929417825 2:41761573-41761595 ATGGTGAGGAGGAAAGAAAGAGG - Intergenic
929444564 2:41992108-41992130 GTGGAGGAGAGGAGAGAGGAAGG + Intergenic
929733861 2:44524566-44524588 ATGAAGATGAGGGAAGAGGAAGG - Intronic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930245891 2:48982993-48983015 ATGGGGTTGAGGAAAGAAGAAGG + Intronic
930247698 2:49002311-49002333 ATTGTAAAGAGAGAAGAGGAAGG - Intronic
930554482 2:52878123-52878145 AATGTGAAGATGAAAAAGGATGG + Intergenic
931142836 2:59482549-59482571 ATGGAGAAGAGGAAAGATTATGG + Intergenic
931198975 2:60078794-60078816 ATGGTTAAAAGGGAAGAGGTAGG + Intergenic
931492731 2:62767043-62767065 ATGAGGGAGAGGTAAGAGGAAGG + Intronic
931506533 2:62933651-62933673 ATAGGGAAGAGGAAAGAGATTGG + Intronic
931647950 2:64442357-64442379 AGGGTGAAGAAGGGAGAGGAAGG - Intergenic
932488307 2:72101050-72101072 ATGTTGAAGAGCAAGGTGGATGG - Intergenic
932621294 2:73266064-73266086 ATGGGGGAGAGGAGAGAGAAGGG + Intronic
932806196 2:74785514-74785536 ATTGTGAGGAGGAAACATGATGG - Intergenic
933196676 2:79398127-79398149 AAGGTTAAGAGAAAAGAGGTGGG + Intronic
933233056 2:79831034-79831056 ATTGAGAAGAGGAAAAAAGAGGG - Intronic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933769673 2:85735041-85735063 AAGGAGAAGAGGGAACAGGAAGG + Intergenic
933791144 2:85884741-85884763 AGGCTGAGGAGGAGAGAGGAAGG + Intronic
934117496 2:88811060-88811082 ATGCTGGAGAGGAAAGGGGAGGG + Intergenic
934511369 2:94946942-94946964 ATTGGGAAGAGGAAAGAGAGTGG - Intergenic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
934874912 2:97908571-97908593 ATGAGCAAGGGGAAAGAGGAGGG + Intronic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935024164 2:99260467-99260489 AGGGTGAACAGGAGAGAAGAGGG - Intronic
935274253 2:101462704-101462726 ATGATGAAGTGGAAACAAGATGG + Intronic
935277094 2:101484355-101484377 ATTGTGGAGAGGAAAGGGCAGGG - Intergenic
935502844 2:103862377-103862399 ATGTTGACAAGGAAAAAGGAGGG + Intergenic
935684760 2:105673480-105673502 AAAGTGAAGCGGAAAGTGGATGG - Intergenic
935787974 2:106566425-106566447 AAGGTGAAGAAGAGAGGGGAAGG + Intergenic
935872321 2:107464398-107464420 ATGGTGATTAGATAAGAGGAGGG - Intergenic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
936161098 2:110084796-110084818 ATGCTGGAGAGGAAAGGGGAGGG + Exonic
936183565 2:110286558-110286580 ATGCTGGAGAGGAAAGGGGAGGG - Intergenic
936664270 2:114576345-114576367 GTCTTGAAGAGGGAAGAGGAGGG + Intronic
936689172 2:114865661-114865683 ATGATGGAGAGGGAACAGGAAGG + Intronic
936765663 2:115845547-115845569 ATGGGGAAGAGGAAAATAGAAGG - Intronic
936820085 2:116510127-116510149 ATGGAAAGGGGGAAAGAGGAAGG - Intergenic
936962677 2:118092571-118092593 AAGGTATAGAGGCAAGAGGATGG + Intronic
936977236 2:118232376-118232398 AAGGAGAAGAGGAAGGAAGAGGG - Intergenic
937012022 2:118571574-118571596 ATGGTGAAAAGGGAAGAGCCTGG - Intergenic
937304144 2:120860805-120860827 ATGGTGATGAGGAAGGAGCTAGG + Intronic
937325351 2:120986815-120986837 ATGGTGCAGTTGAAAGAGCATGG - Intronic
937436426 2:121885547-121885569 TTGGAGAGGAGGAAAGAGAAAGG - Intergenic
937470328 2:122168876-122168898 AAGGCAAAGAGGAAAGAGCAAGG - Intergenic
937635637 2:124152654-124152676 AAGGTAGAGAGGAATGAGGAGGG + Intronic
937756747 2:125548493-125548515 ATGGTAAAGAGGAAAGTTTATGG + Intergenic
938168690 2:129056348-129056370 ATGGTGAATTAGAAAGAGGCTGG + Intergenic
938299582 2:130200652-130200674 ATGGCCAACAGGAAAGGGGAAGG + Intergenic
938344674 2:130558561-130558583 ATGGTGATGAGGCTGGAGGAAGG + Intergenic
938345159 2:130562159-130562181 ATGGTGATGAGGCTGGAGGAAGG - Intergenic
938457128 2:131473834-131473856 ATGGACAACAGGAAAGGGGAAGG - Intronic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938872962 2:135500617-135500639 ATTGGGAAGAGGCAAGAGGGAGG + Intronic
939123919 2:138152304-138152326 AGGGGGAAGAAGAAAGAAGAAGG - Intergenic
939348822 2:141004924-141004946 GTGGTGAAGAGCAAGGAGGGAGG - Intronic
939592373 2:144081645-144081667 AAGGTGGGGAGGAAAGAGGAGGG + Intronic
939733245 2:145811414-145811436 TTGGTGAAGAGTAAAAGGGATGG - Intergenic
939773940 2:146360976-146360998 GAGGAGAAGAGGAAAAAGGAGGG + Intergenic
939886791 2:147689916-147689938 ATGATGAAGATGCATGAGGAAGG - Intergenic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941204862 2:162559104-162559126 ATGGTGCAGTTGAAAGAGTATGG + Intronic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941440045 2:165523371-165523393 ATGGTGGTGAAGAAAGAGGTTGG - Intronic
941654919 2:168133080-168133102 ATGGTGCAGAGGAGACAGGGAGG - Intronic
941723611 2:168837980-168838002 ATGGTGAAGAGAATAGAGTGAGG - Intronic
942045502 2:172097160-172097182 AGGGTGAAGGGGCCAGAGGAAGG - Intergenic
942382668 2:175408231-175408253 ATGGTGTAGTGGAAAGAGTGTGG + Intergenic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943328828 2:186534576-186534598 ATGGTAAAATGGCAAGAGGATGG + Intergenic
943388394 2:187230628-187230650 CTAGATAAGAGGAAAGAGGAAGG + Intergenic
943936964 2:193931647-193931669 AGGGAGAAAAGGAAAAAGGAAGG + Intergenic
944000575 2:194831333-194831355 AAAGTGCAGAGGAAGGAGGAAGG + Intergenic
944212901 2:197225051-197225073 AGGGAGAAAAGGGAAGAGGAGGG + Intronic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944472535 2:200069833-200069855 ATGTTGAAGAGAAATGAGAATGG - Intergenic
944663790 2:201942282-201942304 ATGGTGAAGAGGAAAAAGATTGG + Intergenic
945042780 2:205755885-205755907 AGGGTGAAGAGAAAGGTGGATGG + Intronic
945058933 2:205891706-205891728 ATGGTGTAGAGAAAAAAGAATGG - Intergenic
945192280 2:207201362-207201384 ATGGTGCAGTAGAAAGAGAATGG - Intergenic
945335657 2:208589826-208589848 TTGGATAAGAGAAAAGAGGACGG + Intronic
945749868 2:213768109-213768131 CTAGTGAAGAGGAAAGAACATGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
946032994 2:216719875-216719897 ATGGGGAAGGGGAAAGAAGGAGG - Intergenic
946418204 2:219551081-219551103 ATGGGGAAGAGGAAAGAAAGAGG + Intronic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946555116 2:220847831-220847853 ATGATGGAGAGGAATGAGAAGGG + Intergenic
946592897 2:221271215-221271237 ACCATTAAGAGGAAAGAGGAAGG - Intergenic
946779247 2:223175990-223176012 ATGTTGCAAAGGAAAGATGAAGG + Intronic
947101504 2:226625961-226625983 ATGGTGACAAGGAAAGACCAAGG - Intergenic
947318820 2:228894853-228894875 ATCATGAAGAGGCAACAGGAGGG - Intronic
947341810 2:229148466-229148488 AGGGTGAAGAGGGAGGAGCAAGG + Intronic
947348863 2:229221805-229221827 GTGGTTAAGAGGAATGGGGAGGG - Intronic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947598734 2:231431305-231431327 ATGGTGAAGAGGAAAATAGCAGG + Intergenic
948091818 2:235301830-235301852 AGGATGAAGAGAAAGGAGGAGGG - Intergenic
948102014 2:235382795-235382817 ATGGTGAAGAGGTCTGAGGCGGG - Intergenic
948295682 2:236858557-236858579 TTGGTGAAGACAAAAGGGGAGGG + Intergenic
948364189 2:237444177-237444199 AGGGTCAAGAGGAAAGAGGTAGG - Intergenic
1168942689 20:1726932-1726954 TTGCTGAAGAGAAAAGAAGAGGG + Intergenic
1168950450 20:1796552-1796574 ATGGTGAAGAGAAATGATGTGGG - Intergenic
1169118830 20:3083539-3083561 AGGGCGAGGAGGAAGGAGGAAGG - Intronic
1169232591 20:3901579-3901601 AAGTTGAAGAGGGAAGAGAAGGG - Intronic
1169444365 20:5659150-5659172 ATGCTGAAAAACAAAGAGGAAGG - Intergenic
1169651321 20:7870892-7870914 GTGGAGAAGAGGGAAGAGAAGGG - Intergenic
1169833122 20:9847246-9847268 ATGGTGGAAGGCAAAGAGGAAGG - Intergenic
1169933707 20:10860390-10860412 ATTGTGTAGAGGAGAGATGAAGG - Intergenic
1169979708 20:11370712-11370734 ATGGGCAAGAAGAAAAAGGATGG + Intergenic
1170032272 20:11955891-11955913 AGTGGGAAGAGAAAAGAGGATGG + Intergenic
1170140332 20:13119625-13119647 AAGGTGGGGAGGAAAAAGGAGGG - Intronic
1170206349 20:13802778-13802800 AGAGTGATGGGGAAAGAGGAAGG - Intronic
1170405645 20:16032853-16032875 ATGAGGAAAAGGTAAGAGGAAGG + Intronic
1170503240 20:16996554-16996576 ATGGAGGGAAGGAAAGAGGATGG - Intergenic
1170512278 20:17090436-17090458 ATGCTGTAGTGGAAAGAGCATGG + Intergenic
1170845039 20:19955105-19955127 ATGGGGGAGAGAAAAGAGAATGG - Intronic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171135669 20:22692369-22692391 ATGGGGAAGAGAAAAGATGGAGG + Intergenic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1171206879 20:23288300-23288322 TTGGTGAGGAGGAAAGGGTAGGG + Intergenic
1171383758 20:24753154-24753176 ATGGTGGAGGGAAAAGAGGTAGG - Intergenic
1171433855 20:25104302-25104324 GTGGTGGAAAGGACAGAGGAGGG - Intergenic
1172113990 20:32563073-32563095 AGGGTGAAGGGGAAGGAGGGTGG + Intronic
1172163841 20:32886736-32886758 AGGCTGAAGGGGACAGAGGAAGG + Intronic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172324900 20:34026735-34026757 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1173053019 20:39583667-39583689 AAAGGGAAGAGGAAAGGGGAAGG + Intergenic
1173186309 20:40843215-40843237 AAGGTGAGAAGGAAGGAGGAAGG - Intergenic
1173307399 20:41863358-41863380 TGGGTGCAGAGGAAAGAAGATGG - Intergenic
1173349541 20:42232560-42232582 ATGAGGAAGAGGAAACAGAAAGG - Intronic
1173369928 20:42426417-42426439 ATGGGGAGGTGGAAAGGGGATGG - Intronic
1173550641 20:43930984-43931006 CTAGTGAAGGGGATAGAGGAGGG - Intronic
1174188106 20:48721330-48721352 AAGGTGAAGGGGACAGAGAATGG + Intronic
1174437632 20:50522155-50522177 AGGATAAAGAGAAAAGAGGAAGG - Intronic
1174437853 20:50523981-50524003 AAGGTTAAGACCAAAGAGGAAGG - Intronic
1174568975 20:51487634-51487656 ATGGTGAAGAGGCAAAAGCTAGG + Intronic
1174613145 20:51815538-51815560 ATAGGGAAGAGAAAAGAGCAAGG + Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1176084639 20:63290382-63290404 ATGGGGAAGACGAAAGTGGCGGG + Intergenic
1176187170 20:63787070-63787092 GTGGGGTAGAGGCAAGAGGAAGG + Intronic
1176191006 20:63809543-63809565 AGGGAGAAGAGGGGAGAGGAAGG - Intronic
1176791963 21:13328452-13328474 ATGGTGAACAGGAATGGGAATGG - Intergenic
1176893559 21:14348407-14348429 ATTGAGAAAAGGAAAGAAGACGG + Intergenic
1177639049 21:23822462-23822484 CTTGTGAAGTGGAAAGAGAATGG + Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178021665 21:28415281-28415303 GTGGTGGAGAGGAAAGAGAATGG + Intergenic
1178120652 21:29466851-29466873 AGGGTTAAGAAGAAAGAGAAAGG - Intronic
1178225363 21:30710904-30710926 GAGGAGGAGAGGAAAGAGGAGGG + Intergenic
1178399781 21:32275615-32275637 AGGGTGAAGAGAAATGAAGAAGG + Intronic
1178931060 21:36819781-36819803 ATGGGAAAGTGGAAAGAGTATGG - Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1179915658 21:44476556-44476578 ATGGAGATGAGGATATAGGATGG + Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180469394 22:15641758-15641780 AGGGGGAGGAGGAAAGAGGGTGG - Intergenic
1180525454 22:16254901-16254923 AGGAAGAAAAGGAAAGAGGAAGG + Intergenic
1180626870 22:17199425-17199447 GAGGGGAAGAGGATAGAGGAGGG - Intronic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182093026 22:27608962-27608984 ATGGCTAGGAGGAGAGAGGAGGG + Intergenic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1182951594 22:34381306-34381328 ATGGGGATGAAGAAAGAGGTAGG + Intergenic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1183828994 22:40408201-40408223 ATGGCAGAGAGGACAGAGGAGGG + Intronic
1184082004 22:42228598-42228620 TTTGTGAAGAGGAACGAGGCTGG + Intronic
1184331947 22:43833056-43833078 ATGGGAAAGAGGAGAGACGATGG - Intronic
1184409702 22:44319419-44319441 GGGATGAAGGGGAAAGAGGAGGG + Intergenic
1184504586 22:44893168-44893190 AGGGTGAAGAGGCAAGAAGCCGG + Intronic
1184665425 22:45986555-45986577 ATGGAGCAGAGGAAAGGGGGAGG + Intergenic
1184753437 22:46502387-46502409 AGGGTAAAGTGGAAAGAAGAGGG + Intronic
1184753455 22:46502438-46502460 AGGGTAAAGTGGAAAGAAGAGGG + Intronic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949689667 3:6621295-6621317 ATGGGGAATTGGAAAGGGGATGG - Intergenic
949877643 3:8636736-8636758 CCTGTGAAGAGAAAAGAGGAGGG - Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
950120402 3:10478649-10478671 ATGATGGAGAAGAAAGAGGCAGG - Intronic
950210928 3:11122568-11122590 ATGGTGGAGGGTAGAGAGGAGGG - Intergenic
950257535 3:11518064-11518086 ATGGTGAGTGGGAGAGAGGAAGG + Intronic
951604028 3:24411727-24411749 ATGGGGATGGAGAAAGAGGATGG + Intronic
951839676 3:27021156-27021178 ATGGTGAGGATGATAGAAGATGG + Intergenic
952252169 3:31665647-31665669 AGGGTACAGTGGAAAGAGGAGGG - Intronic
952358506 3:32606398-32606420 AAAATGAAGAGGAGAGAGGAGGG + Intergenic
952504124 3:33992213-33992235 CTGGTCAAGAGGAAAGATAAAGG - Intergenic
952716482 3:36485321-36485343 ATGGTGGAGTGGAAAGAACACGG + Intronic
952749551 3:36814366-36814388 ATGGGGAGGAGGGAAGAGCAAGG - Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952836137 3:37603843-37603865 AGGGTGTGGAGGAAAGAGCAGGG - Intronic
952987088 3:38795139-38795161 ATAGAGAACAGGAGAGAGGAGGG - Intergenic
953043408 3:39274582-39274604 ATTTTGAAGAGGAAAGGGAAGGG - Intronic
953085907 3:39667014-39667036 ATGGTACAGTGGAAAGAGCATGG + Intergenic
953200694 3:40776405-40776427 AGGGTGAATAGGATAGAGGCAGG + Intergenic
953206277 3:40832784-40832806 ATGGAGCAGAGGAGAGAGAAGGG - Intergenic
953358538 3:42275143-42275165 AGGGAGAAGAGGGAATAGGAAGG + Intergenic
953383569 3:42492221-42492243 AGGAGGAAGAGAAAAGAGGAAGG - Intronic
953685316 3:45073582-45073604 ATGGTGAAGGAGAAAGAGATAGG + Intergenic
954726510 3:52616020-52616042 CTGCTGAGGAGGTAAGAGGAGGG - Intronic
954952064 3:54484270-54484292 ATGGAGAATAGGAAGGAGAATGG - Intronic
954995036 3:54873354-54873376 AAAGTGAAGAAGGAAGAGGAAGG - Intronic
955045588 3:55356977-55356999 ATGGTGAAGAGAAGGGAGTATGG - Intergenic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
955555696 3:60134939-60134961 ATGGAGTAGAGGAAAGAGAAAGG + Intronic
955856777 3:63280591-63280613 TTGGGATAGAGGAAAGAGGAAGG - Intronic
956054461 3:65283917-65283939 GTGGTAAAGAGGAAGGAGGCAGG - Intergenic
956294538 3:67697375-67697397 ATGATAGAGAGGAAATAGGAGGG + Intergenic
956403414 3:68903901-68903923 ATGGAAAGGAGGAAAGAGGGAGG - Intronic
956528441 3:70190239-70190261 ATGGTGACAGGGAAACAGGAGGG - Intergenic
956695087 3:71911902-71911924 ATGGTGAAAAGAAATAAGGATGG + Intergenic
956849697 3:73217711-73217733 AGGGGGAAGAGGGAAGGGGAGGG - Intergenic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
956991846 3:74775600-74775622 ATGATGGAGAGCAGAGAGGAAGG - Intergenic
957024001 3:75159143-75159165 ATGGTAAAGAGGAGAATGGATGG - Intergenic
957926155 3:86814673-86814695 ATGATGCAGGGGAAAAAGGAGGG - Intergenic
958023953 3:88028435-88028457 ATGGAGAACTGGAAAGGGGATGG - Intergenic
958605932 3:96358471-96358493 ATGTTGAATAGGAATGAGGTGGG + Intergenic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959204898 3:103294139-103294161 ATGGTGAAGAAGAGAAAGAAAGG + Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959369061 3:105500275-105500297 AAGGAGATGAGAAAAGAGGAAGG - Intronic
959927619 3:111941504-111941526 TAGGTTAAGAGGAAAGGGGAAGG + Intronic
959951095 3:112181157-112181179 ATTATGAATAGTAAAGAGGAAGG + Intronic
959986750 3:112581703-112581725 ATGGTGGAAAAGAAAGAGAAAGG - Intronic
960060605 3:113317038-113317060 AGGCTGAAGAGGAAAGAAGCTGG + Intronic
960223603 3:115146328-115146350 ATGCTGAAGAGGCAGGAGGCAGG - Intronic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
961242792 3:125426741-125426763 ATGGTGAAAGGCGAAGAGGAAGG + Intergenic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961597777 3:128032498-128032520 AGGGTGAAGATGGAATAGGAAGG - Intergenic
961735237 3:128997277-128997299 ATGGGGAAGGGGCAAGAAGAAGG - Intronic
961774175 3:129272147-129272169 TTGGTCAATAGGAAAGAGGTGGG + Intronic
961817330 3:129557914-129557936 AGGTTGAAGATGAAAGAGGATGG - Intronic
962120664 3:132556958-132556980 AAGGAGCAGAGGAAAGGGGAGGG - Intergenic
962379488 3:134886097-134886119 AAGGTGAAGTGTAAAGAGGCAGG + Intronic
962425846 3:135268664-135268686 ATGGTGAGGAGCACAGAGAATGG - Intergenic
962430674 3:135316380-135316402 ATGGTGAAGAGAAAAATGAAGGG + Intergenic
962506243 3:136048992-136049014 ATGGTAAAACGGAAACAGGAAGG - Intronic
963045311 3:141098048-141098070 TTGGTGAAGAAGAAAGGGCATGG - Intronic
963179204 3:142336418-142336440 AAAGAGAAGAGGAAAAAGGAAGG + Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
963656360 3:148056439-148056461 ATGGTGAAGAGGAAATAATAAGG - Intergenic
963943931 3:151124461-151124483 ATGCTGAGGAGGGAAGGGGAAGG - Intronic
964041466 3:152267216-152267238 GTGGAGAAGAGAAAAGAGCAGGG - Intronic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964207884 3:154195082-154195104 AATGTGCAGTGGAAAGAGGAGGG + Intronic
964247445 3:154669905-154669927 ATGTTGAAGAGGCAGCAGGATGG + Intergenic
964833332 3:160910251-160910273 AAGGGGAAGGGGAAAGGGGAAGG - Intronic
964990307 3:162802601-162802623 ATAGAGAAGAGGCAAGTGGATGG + Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
965189580 3:165511221-165511243 TTGGGGAAGAGTAAAAAGGAAGG - Intergenic
965617712 3:170611953-170611975 ATGGTGAAGAGGAAATGGAGTGG - Intronic
965666083 3:171094781-171094803 AGGGTGAAGAGAAAAGAAGAGGG - Intronic
965923223 3:173944968-173944990 ATGGTGAAGAGAAAATGAGATGG + Intronic
966281239 3:178231956-178231978 ATGGTGAAATGAAAAGAGAATGG - Intergenic
966507656 3:180725073-180725095 ATGGTGGAAGGGGAAGAGGAAGG - Intronic
966739985 3:183223615-183223637 AAGAGAAAGAGGAAAGAGGACGG + Intronic
966753215 3:183342284-183342306 ACGGTACAGAGGAAAGAGCAAGG + Intronic
966775329 3:183538410-183538432 ATGGTGAAGAAATAAGAGGAAGG - Intronic
967112377 3:186305420-186305442 ATGCTGAAAAGGAATGAAGATGG + Intronic
967303653 3:188040503-188040525 ATGGGCAAGAGGGAAGAGGCAGG + Intergenic
967644399 3:191903772-191903794 CAAGTGAAGAAGAAAGAGGAAGG - Intergenic
967686123 3:192418764-192418786 ATGGTGTAAGGCAAAGAGGAAGG - Intronic
967713072 3:192731606-192731628 ATGTCAAAGAGGAAAGTGGACGG + Intronic
968123361 3:196141662-196141684 AGGGGAAAGAGGAAAGAAGAAGG + Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968530199 4:1087212-1087234 ATGGGGTAGGGGAGAGAGGACGG + Intronic
968549350 4:1214296-1214318 ATGGTGGACAGGGAAGAGCAGGG + Intronic
968562584 4:1292416-1292438 CTGGTGAAGTGGGAAGAGAATGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969239799 4:5890677-5890699 AGGGAGAAGAGGAAGGAGTAGGG + Intronic
969338530 4:6526538-6526560 TTGGTGAAAAGAAAAGAAGAGGG + Intronic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
970027318 4:11637163-11637185 ATGGTGAAAAATGAAGAGGAAGG + Intergenic
970044064 4:11830093-11830115 ATGGAGCAGAAGAAAAAGGAAGG + Intergenic
970133346 4:12894975-12894997 ATGATGAAGGGGAATGAGGGTGG - Intergenic
970263850 4:14259315-14259337 AGGGTGAAGAGGAAAGAGCATGG - Intergenic
970368835 4:15387947-15387969 AGGGAGAAGAGGAGAGAAGATGG + Intronic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970415784 4:15855601-15855623 ATGGAGAAGAGGGTAGAGAATGG + Intergenic
970481858 4:16484217-16484239 ATGATGAAGAGGAAAGACACAGG + Intergenic
970682251 4:18523499-18523521 GTGGTGAATAGAAAAGAAGAAGG - Intergenic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
970904937 4:21204453-21204475 ATGGTGAAGTGGAAATACGGTGG + Intronic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
970939620 4:21616133-21616155 ATGATGAAGATGCAAGAGGAAGG - Intronic
970973791 4:22019223-22019245 AAGGAGAAGAGGAAAGAAAATGG - Intergenic
971005673 4:22371793-22371815 ATGGTGGAAAGGTAAGAGGAAGG - Intronic
971174459 4:24267417-24267439 AGGGTGAAGGGGAAAGGGAAGGG - Intergenic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
971631706 4:29000678-29000700 ATGGTGAAGAGGGAAGATGATGG + Intergenic
971636645 4:29068717-29068739 AGGGAGAAGGGGAAAGGGGAGGG - Intergenic
971663381 4:29449955-29449977 AGGAAGAAAAGGAAAGAGGAGGG + Intergenic
971670083 4:29545193-29545215 ATGGTGAGAAGGACAGAGAAAGG + Intergenic
971827225 4:31640812-31640834 ATCCTGAAGAGGAAAGAGATTGG - Intergenic
971978957 4:33729717-33729739 ATTTTGAAGAAGAAAGAGAACGG + Intergenic
972230406 4:37065997-37066019 ATCCTGAAGAAGAAAGAGCATGG + Intergenic
972302285 4:37796164-37796186 ATGGTGTGGAGGAAAAAGGAAGG - Intergenic
972396052 4:38660802-38660824 ATGGTGAAGAGGAGGGAAGAGGG - Intergenic
972861021 4:43169285-43169307 ATGGTGAAGAGGAATGGAGCCGG - Intergenic
972909408 4:43796580-43796602 AAGGGGAAAAGGAAAAAGGAAGG + Intergenic
973178620 4:47240869-47240891 AAGGTGAAGGAGAAAGAGAATGG - Intronic
973775523 4:54237894-54237916 ATGGTGAAGTGGAGAGGGCATGG + Intronic
974020026 4:56684871-56684893 ATGGTGGAAAGGAAAGAGTGTGG + Intergenic
974744559 4:66055338-66055360 ATGTTGAAAAGGAACAAGGATGG - Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975104615 4:70553763-70553785 GTGGTGAACAGGAAAGACAATGG - Intergenic
975366335 4:73533281-73533303 ATGGTTTAGAAGAAAGAAGAGGG - Intergenic
975575039 4:75854041-75854063 AGGGTGGGGAGGATAGAGGATGG + Intergenic
975684447 4:76905741-76905763 ATGGGGAGGAGGGAACAGGATGG + Intergenic
975707065 4:77121887-77121909 ATGGGGAATTGGAAAGGGGATGG + Intergenic
976007387 4:80446110-80446132 ATGAGGAAGAAGAGAGAGGAAGG + Intronic
976031010 4:80753684-80753706 AAACTGAAGAGCAAAGAGGAGGG - Intronic
976132634 4:81901001-81901023 ATAGTGAATAAGAAAGACGAGGG - Intronic
976561911 4:86511614-86511636 AGGAGGAAGAGGAAAGAAGAAGG + Intronic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
976957680 4:90922299-90922321 AAGGAGAAGAGGGAAGGGGAAGG + Intronic
977116026 4:93030236-93030258 CGGGAGAAAAGGAAAGAGGAAGG - Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
977613200 4:99058135-99058157 ATGTAGGAGAGGGAAGAGGAGGG + Intronic
977937974 4:102827580-102827602 GCGGTGAAGAGGCAGGAGGAGGG - Intronic
978268570 4:106859061-106859083 AGGGTGAAGGGGGAGGAGGAGGG + Intergenic
978444256 4:108765428-108765450 AGAGTGAAGAGAAAAGAAGAGGG - Intergenic
978724540 4:111955137-111955159 ATCAGGAAAAGGAAAGAGGAGGG - Intergenic
979012685 4:115391362-115391384 ATGTTGAATAGGAATGATGAGGG - Intergenic
979167706 4:117557577-117557599 TTGGTGAGGAGGAAAGAGGTGGG + Intergenic
979348546 4:119619004-119619026 ATTGAAAAGAGAAAAGAGGATGG - Intronic
979480776 4:121214447-121214469 GTGGAGAAGAGGCAAGAGAATGG + Intronic
979521101 4:121667662-121667684 ATAGGAAAGAGGAAAGAGAAAGG + Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979844768 4:125494046-125494068 ATAGTTAAGAGTAAAGGGGAAGG + Intergenic
979892792 4:126120969-126120991 ATGAGGTAGAGGAAAGAGTAAGG + Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
980314852 4:131185540-131185562 ATCCTTAAAAGGAAAGAGGAAGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
980812743 4:137903889-137903911 AGGGTAGAAAGGAAAGAGGAAGG + Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
981289699 4:143060087-143060109 ATGGTGAAGACACAAAAGGAGGG - Intergenic
981313558 4:143319649-143319671 ATAGAGCAAAGGAAAGAGGAAGG + Intergenic
981317413 4:143353103-143353125 AAGATGAAGAGGAGAGATGAAGG + Intronic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981626683 4:146764390-146764412 GTGGGGAGGAGGAGAGAGGAGGG + Intronic
981840303 4:149103900-149103922 ATGGTAAAGGGTAAAGAGAAAGG - Intergenic
982631933 4:157841180-157841202 ATGGTAAAGAAGAAAGCGTAGGG - Intergenic
982720417 4:158854322-158854344 ATAGGGGAGAGGAGAGAGGAGGG - Intronic
982840385 4:160176754-160176776 ATGGAGAATAGGAAAAAGCAGGG + Intergenic
982904029 4:161045912-161045934 ATTCTGATGAGGAAAAAGGAGGG - Intergenic
983484408 4:168317416-168317438 ATGGAAAAGAGAAAAAAGGAGGG + Intronic
983499426 4:168482210-168482232 AAGGTGCAGAGGAAAGAGAGTGG - Intronic
983698669 4:170564926-170564948 ATGGTGAAATGGAAAGAGCATGG - Intergenic
983983260 4:174025324-174025346 ATGGTGAAAAAGGAAGAGAAAGG + Intergenic
984098059 4:175455508-175455530 ATGGGGAACTGGAAAGGGGATGG + Intergenic
984250760 4:177331997-177332019 ATGGTGGAGAGGTAAGAACATGG - Intronic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
986071258 5:4286961-4286983 ATGGAAAACAGGAAAGAAGAGGG - Intergenic
986429626 5:7668676-7668698 ATGGTGGAGAGAAAAGAGTATGG + Intronic
986542031 5:8854588-8854610 ATGGTGCTGAGGACAGTGGAGGG - Intergenic
987057978 5:14213222-14213244 AGAGTGAAAAGAAAAGAGGAGGG - Intronic
987268280 5:16278685-16278707 ATGGGGAATGGGAAAGGGGATGG - Intergenic
987512953 5:18865333-18865355 AATATGAAAAGGAAAGAGGATGG + Intergenic
987862265 5:23503996-23504018 ACGGTGAAAGGCAAAGAGGAAGG - Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988403892 5:30799414-30799436 TTGCTGAAAAGGAAAGATGAAGG - Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988609500 5:32711694-32711716 AGAGTGGGGAGGAAAGAGGAAGG + Exonic
988908707 5:35817451-35817473 GTGGTGTGGAGGAAAGAGCATGG - Intergenic
989056589 5:37371358-37371380 AGGGTGAGGAGGAAGGAGGGAGG + Intergenic
989238978 5:39181789-39181811 ATGGAGATGAGAAAAGAGGTTGG - Intronic
989552983 5:42757284-42757306 GAGGTGAGGAGGAAAGAGGAGGG + Intronic
989600187 5:43193292-43193314 AGGGAGAAGAGGGAAAAGGAGGG - Exonic
989628568 5:43457476-43457498 ATGGTGGAAGGTAAAGAGGAAGG + Intronic
989678092 5:43996626-43996648 ACGGTGTAGAGGAAAGAGTGTGG + Intergenic
989705707 5:44327813-44327835 CTGGTGATGATGAAAGAGGAAGG - Intronic
989726395 5:44591483-44591505 AGGATGAAGAGGAAATATGAGGG - Intergenic
989770615 5:45140225-45140247 ATGGTGGAAGGCAAAGAGGAAGG - Intergenic
989954296 5:50338587-50338609 AAAGAGAAAAGGAAAGAGGATGG + Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
990379721 5:55210925-55210947 ATGGGGAGGTGGTAAGAGGAAGG + Intergenic
990513036 5:56506378-56506400 ATGGTAAAAAGGAATCAGGAAGG - Intergenic
990528572 5:56652209-56652231 ATGGTGAAGAGTGAAGAGAAAGG - Intergenic
990556551 5:56942217-56942239 AGGGTAGAGAGAAAAGAGGAAGG + Intronic
990690248 5:58355747-58355769 AGGGTGAGGGGGAAGGAGGAAGG - Intergenic
990998422 5:61757182-61757204 AGGGTGAAGAGGGAAGATAAAGG + Intergenic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
991480852 5:67077550-67077572 ATGGTGAGGAGCAAAGTGGATGG - Intronic
991540310 5:67720479-67720501 AGGGAGAAGAGGAGAGGGGAGGG - Intergenic
992037940 5:72799518-72799540 ATTGTGAAGATGCAAAAGGAAGG + Intergenic
992110993 5:73493513-73493535 ATGGTTATGAGCACAGAGGATGG + Intergenic
992126634 5:73649271-73649293 AGGGTGAGTAGGAAAGAGGTGGG + Intronic
992226086 5:74620787-74620809 ATGGGGAGCTGGAAAGAGGATGG + Intergenic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
992489530 5:77228688-77228710 ATGGAGAAAATGAAAGATGAGGG + Intronic
992955494 5:81904072-81904094 ATAGTGGAGAGGAAGGAGAATGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993367384 5:87050333-87050355 TTGGGGAAGAGGTAAGTGGATGG - Intergenic
993373362 5:87119168-87119190 AGGGAGAAGAGGAAAGCGGAGGG + Intergenic
994203759 5:97008949-97008971 CAGGTAAAGAGTAAAGAGGAGGG - Intronic
994721962 5:103390820-103390842 ATTGTGGAGTAGAAAGAGGAAGG - Intergenic
995105629 5:108374704-108374726 AGGGAGGTGAGGAAAGAGGAGGG + Intronic
995121131 5:108536202-108536224 ATGGAGAGCTGGAAAGAGGATGG - Intergenic
995570666 5:113477658-113477680 GTGGTGCAGAGGGAAGAGGAAGG + Intronic
995638763 5:114228020-114228042 ATGATGATGATGAAAGAAGAAGG + Intergenic
995830505 5:116349362-116349384 CTGATGAAGAGGAAAAAGCAGGG + Intronic
995907168 5:117139242-117139264 TTGGTGAACATGGAAGAGGAAGG + Intergenic
996204837 5:120720267-120720289 ATGATGAAAATGAAAAAGGAAGG - Intergenic
996387529 5:122925075-122925097 AAGGAGGAGAGGGAAGAGGAGGG - Intronic
996418317 5:123234001-123234023 AAGGGGAAGGGGAAAGAGAAAGG - Intergenic
996534601 5:124564463-124564485 AGGAGGAAGAGGAAAGAGAAGGG + Intergenic
996540024 5:124620924-124620946 ATGGTAAGGAACAAAGAGGATGG + Intergenic
996629701 5:125612682-125612704 CTAGAGAACAGGAAAGAGGAAGG + Intergenic
996890332 5:128411427-128411449 ATGGGGAGGTGGAAAGCGGACGG + Intronic
997011131 5:129878935-129878957 AGGGTATAGAGGAAAGAGTAAGG - Intergenic
997766003 5:136503989-136504011 ATGGGGATGAGGCAGGAGGAAGG - Intergenic
998014794 5:138723532-138723554 ATGGAGAAGATGAAAGAGAGGGG + Intronic
998261923 5:140638290-140638312 AAAGTGGAGAGGAAAGGGGAAGG + Intergenic
998384647 5:141749784-141749806 GTGGTGAGGAGGACAGAGGCTGG + Intergenic
998987884 5:147782436-147782458 ATGGTGAGTAGGAAACAGTAGGG - Exonic
999143970 5:149380668-149380690 AATGTGAGGAGGACAGAGGAGGG + Intronic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999541363 5:152576023-152576045 ATGGTGAGGAGGAATGGGAAGGG + Intergenic
999860494 5:155640510-155640532 AAGGGGAAGAGAAAAGAGGAAGG - Intergenic
1000182231 5:158822589-158822611 ATGGTGAAGAGGTAAGAGTTAGG + Intronic
1000187074 5:158869491-158869513 TTGGAGAAGAGGAAATAGGAGGG - Intronic
1000243118 5:159426837-159426859 AGGTTGTAGGGGAAAGAGGATGG - Intergenic
1000378956 5:160611762-160611784 ATGGAGAAAACGAAAGAAGACGG - Intronic
1000932708 5:167271195-167271217 ATGGTGAGGAGGAGTGGGGAGGG + Intergenic
1001101852 5:168820910-168820932 GCGGGGAAGAGGAGAGAGGAAGG - Intronic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001593406 5:172881884-172881906 AGGGTGAAGAGAATGGAGGAGGG - Intronic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001685303 5:173590238-173590260 AAGGAAAAGAGAAAAGAGGAAGG + Intergenic
1001705171 5:173736343-173736365 ATGCTGGAAAGGAAACAGGATGG - Intergenic
1001741480 5:174056388-174056410 ATGATCAATAGGAAAGAGTATGG + Intronic
1001783724 5:174393448-174393470 AGGATGAAGAGGAAAATGGAAGG + Intergenic
1002020024 5:176358006-176358028 ATGATGATGAAGAAAGATGATGG - Intronic
1002345013 5:178542685-178542707 AAGGTGGAGAGGAAGGGGGAGGG + Intronic
1002663251 5:180804830-180804852 CAGGTGAAGGGGAAACAGGATGG + Intronic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003148740 6:3530976-3530998 TTGGTGAAGAGGCAGGAGTATGG + Intergenic
1003194015 6:3899011-3899033 ATGGGGAATTGGAAAGGGGATGG + Intergenic
1003403361 6:5809088-5809110 AAGGAGAAGGGGAAAAAGGAAGG - Intergenic
1003707065 6:8544586-8544608 ATTGTGAAGAGGAGAGGAGAGGG - Intergenic
1003714496 6:8631536-8631558 ATGCTGAAGTGGAAACTGGAAGG - Intergenic
1003982781 6:11405075-11405097 ATGGGGAAGGGGATAGGGGAAGG + Intergenic
1004072337 6:12311935-12311957 AGGGTGAAGATAAAACAGGAGGG - Intergenic
1004141344 6:13020643-13020665 AAGGTCAAGAGGCCAGAGGAGGG + Intronic
1004827602 6:19440390-19440412 ATGGTGTAGTGGAAAGAACATGG - Intergenic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005446644 6:25930861-25930883 ATGGTGTGGAGGAAAGGGCAGGG + Intergenic
1005761476 6:28971859-28971881 AAATTGAGGAGGAAAGAGGAAGG - Intergenic
1005952880 6:30644412-30644434 ATGGAGGAAAGGAGAGAGGAAGG - Intronic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006237163 6:32643718-32643740 AAGGTGACAAGGGAAGAGGAAGG - Intronic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006517642 6:34553665-34553687 CTGGAGAAGAGGAAAGAGAGAGG + Intronic
1007154498 6:39729270-39729292 ATGGGGAAGAGAGAAGAGAATGG + Intergenic
1007515327 6:42406281-42406303 GAGATGAAGAGGGAAGAGGAAGG - Intronic
1007682528 6:43644533-43644555 CTGGTGAAGATGGAAGAGAATGG + Intergenic
1007693511 6:43717724-43717746 ATGGTGGAGAGGTGAGAGGCCGG + Intergenic
1007721498 6:43887901-43887923 ATGGTGAAGAGGAGAGACTGTGG + Intergenic
1007837612 6:44686119-44686141 ATCCTGAACATGAAAGAGGATGG + Intergenic
1008333448 6:50270943-50270965 ACGGGCAAGAGGAGAGAGGAAGG + Intergenic
1008600818 6:53092152-53092174 ATGGTGGTGAGGAAATAGGGAGG - Intronic
1008754545 6:54778500-54778522 ATGGTGGAAAGTGAAGAGGAAGG + Intergenic
1008800492 6:55362978-55363000 AGGAAGAAGAGGAAACAGGAAGG + Intronic
1009244136 6:61213981-61214003 TGGGTGAAGAGGAAAGAAGGAGG + Intergenic
1009399866 6:63241911-63241933 TTGCTGAAAAGGAAAGGGGAAGG + Intergenic
1009627082 6:66147629-66147651 TAGGGGAAGAGGAAAGAGGGAGG - Intergenic
1009671935 6:66765169-66765191 ATTGGGAAGAGAGAAGAGGAAGG - Intergenic
1009850662 6:69193969-69193991 ATGATGAAGAAGACAGATGATGG - Intronic
1010431639 6:75784463-75784485 ATGGAGAAGAGCAAAGTGAAAGG + Intronic
1010475159 6:76277540-76277562 ATTGTGAAGGGTAGAGAGGAGGG - Intergenic
1011071518 6:83390811-83390833 ATGGGGAAGAGGGTAGAGGTAGG - Intronic
1012055068 6:94395752-94395774 AAGGAGAGGAGGAAGGAGGAGGG + Intergenic
1012743694 6:103055046-103055068 ATGGGGAGGTGGAAAGCGGATGG + Intergenic
1012873290 6:104696523-104696545 CTGCAGAAGAGGAAAGGGGAAGG + Intergenic
1013029596 6:106320268-106320290 ATGGGGCAGGGGAAAGAGGAGGG + Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1013598084 6:111679084-111679106 AGGTTGCAGAGGAGAGAGGAGGG - Intronic
1014374547 6:120656937-120656959 GTGTTGAAGAGCAAACAGGAAGG + Intergenic
1014573157 6:123036619-123036641 AAGGTGAAGGGAAAAGGGGATGG - Intronic
1014583667 6:123170285-123170307 ATGGTGAAGTGAAAGGAGCATGG + Intergenic
1014899296 6:126943716-126943738 AAGGTTAAGAGTTAAGAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015389699 6:132667762-132667784 GGGATGAACAGGAAAGAGGAAGG - Intergenic
1015720501 6:136236277-136236299 CTTGTGAAGAGGAAAGAGAAGGG + Intronic
1015720544 6:136236667-136236689 CTTGTGAAGAGGAAAGAGAAGGG - Intronic
1016058626 6:139604858-139604880 AAGATGAAGAGAAAAGATGAAGG + Intergenic
1016360382 6:143261088-143261110 ATGTTGCAGAGGAATGGGGAAGG + Intronic
1016855243 6:148662855-148662877 ATGGGGAAGGGGAAAGATCAAGG - Intergenic
1016969210 6:149747182-149747204 ATTCTGAGGAGTAAAGAGGAAGG - Intronic
1017056799 6:150443863-150443885 ATGGTGCAGCAGAAAGAGGCTGG + Intergenic
1017551988 6:155518793-155518815 AAGGAGAAGTGGTAAGAGGAAGG - Intergenic
1017804008 6:157927113-157927135 ATGGAAAACTGGAAAGAGGAAGG + Exonic
1017918855 6:158854434-158854456 GGGCTGGAGAGGAAAGAGGAAGG + Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1018072595 6:160178678-160178700 ATGGTGAGGAGGAGAGTAGAAGG - Intronic
1018280767 6:162183222-162183244 ATAGGGAAGATGTAAGAGGATGG + Intronic
1018542889 6:164902128-164902150 ATGGCAAAGTGGAAAGAGGGTGG + Intergenic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1018844736 6:167547608-167547630 AAGGTGAGGAGGGAAGAGGGAGG - Intergenic
1018928993 6:168227448-168227470 ATTGTGAAGTGGAAAAAGGCAGG + Intergenic
1019494925 7:1333366-1333388 AGGGGGAGGAGGAGAGAGGAGGG - Intergenic
1019757379 7:2782802-2782824 AAGGTCAGGAGGAAGGAGGATGG - Intronic
1019899460 7:4008575-4008597 AAAGCGAAGAGGAAAGGGGAAGG + Intronic
1020207156 7:6127708-6127730 ATTGTGAAGAATAAAGTGGAAGG - Intronic
1020342795 7:7130977-7130999 AAGGGGAAGAGGAAAGAGAAGGG - Intergenic
1021629814 7:22633653-22633675 ATGATGAAGAGGAGAGGGGATGG + Intergenic
1021879664 7:25082438-25082460 AAGGTGAAGAGGGAGGAGGCAGG + Intergenic
1022035293 7:26528260-26528282 ATGGTGAAAAGAAAAAAGGCAGG + Intergenic
1022376128 7:29813121-29813143 ATGGGGAAGAAGAAAGAGCCTGG - Intronic
1022421458 7:30227205-30227227 AGGCAGAAGAGGAAAGAGAAGGG - Intergenic
1022466507 7:30656030-30656052 ATGGGAAAGAGGGAAAAGGAAGG + Intronic
1022731287 7:33028757-33028779 AAAGTGTAGAGGAAAGAGGCCGG + Intronic
1022799776 7:33765141-33765163 ATGATTCAGAGGAAAGAGCATGG + Intergenic
1022827357 7:34029424-34029446 ATGGAGGAGAGGCAAAAGGAAGG + Intronic
1022890379 7:34690771-34690793 AGGGTGAAGAAGAAAAAGTATGG + Intronic
1022988071 7:35679822-35679844 ATAGGGAAGAAGTAAGAGGAAGG - Intronic
1023173658 7:37414397-37414419 AAGGTGGAGAAGAGAGAGGACGG + Intronic
1023198397 7:37666795-37666817 AGGGTGAGGAGAGAAGAGGAAGG - Intergenic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1023809687 7:43902159-43902181 ATGGTGGAGAGGGAGGAGGAGGG + Intronic
1023863129 7:44227177-44227199 AGGGTGCAGGGGACAGAGGAGGG + Intronic
1024130130 7:46343052-46343074 CTGCTGAAGAAGAATGAGGAAGG - Intergenic
1024210998 7:47204009-47204031 AGAGGGAAGGGGAAAGAGGAAGG - Intergenic
1024525296 7:50343271-50343293 ATGGAGAAAAGAAGAGAGGAAGG - Intronic
1024630827 7:51245313-51245335 AAAGTGAAGATGAAAGAGTATGG - Intronic
1024922777 7:54577336-54577358 ATGGTGAAAAAGGAAGAGGCAGG - Intergenic
1025246746 7:57323303-57323325 CCAGTGAGGAGGAAAGAGGAGGG - Intergenic
1025806702 7:64839588-64839610 ATGGACAAAAGGAAAAAGGAGGG + Intergenic
1025945395 7:66100454-66100476 ATGAGGAGGAGGAAAGAGGGAGG + Intronic
1026419040 7:70213759-70213781 ATGGTAAAGAAGAAATAGCATGG + Intronic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1026680224 7:72461027-72461049 ATGGAGAGAAGGAAGGAGGAAGG - Intergenic
1026737315 7:72957256-72957278 AAGCTGAAGAGGAAAGGGGCAGG + Intergenic
1026787517 7:73311254-73311276 AAGCTGAAGAGGAAAGGGGCAGG + Intergenic
1026834829 7:73631738-73631760 AGGGAGAAGGGGAGAGAGGAAGG - Intergenic
1026968638 7:74454859-74454881 TGGGTGGAGAGGACAGAGGAGGG + Intronic
1027106417 7:75407812-75407834 AAGCTGAAGAGGAAAGGGGCAGG - Intronic
1027140149 7:75650943-75650965 AGGGAGAAGAGGGAAGAGAAAGG + Intronic
1027224392 7:76234882-76234904 CTGGTGCAGAGGGAAGCGGACGG - Intronic
1027229980 7:76267129-76267151 ATGGTGAAAAGGCAGGTGGAGGG + Intronic
1027333460 7:77123273-77123295 ATGGTGCGGTGGAAAGAGCAGGG + Intronic
1027706143 7:81535912-81535934 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1027813844 7:82943677-82943699 ATTGTGCAGAAGAAAGAGAAAGG + Intronic
1027958907 7:84918932-84918954 ATGGTGAAAAGCAAAGAGGAAGG + Intergenic
1028097646 7:86782173-86782195 AGGGTGAAAGGGAAGGAGGAAGG - Intronic
1028628700 7:92908345-92908367 ATGATGGAGTGGAAAAAGGATGG - Intergenic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029211993 7:98916780-98916802 AGGATGAGGAGGATAGAGGAGGG - Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029367274 7:100124764-100124786 ATGGGGAAGAGAAAACAGAAGGG + Exonic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029655888 7:101924156-101924178 ATGGGGAGGAGGACAGAGGATGG + Intronic
1029782335 7:102748038-102748060 ATGGTGCGGTGGAAAGAGCAGGG - Intergenic
1029905655 7:104090944-104090966 AGGGTGCTGGGGAAAGAGGAAGG + Intergenic
1030653779 7:112144003-112144025 AAGCTGAAGTGGAAAGAGTATGG + Intronic
1030781848 7:113610679-113610701 ATGGGGAAGAGGGGAGAAGAGGG + Intergenic
1031041162 7:116839782-116839804 ATGAGGAAGAGGAAAGATGAGGG + Intronic
1031101737 7:117489309-117489331 ATGCTGAAGAAGAAAGTGGTAGG + Intronic
1031444067 7:121829163-121829185 AGGGTGAAGAGGAGAGAAGAGGG - Intergenic
1031696178 7:124857682-124857704 AAGGGGAAGTGAAAAGAGGATGG - Intronic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032399060 7:131611046-131611068 AGGGTGGAGAGAAAAGAGAAGGG - Intergenic
1032425445 7:131819005-131819027 ATGGGGCAGGGGAAAGAGAAAGG + Intergenic
1032531399 7:132623651-132623673 ATGGGGTAGAGCAAACAGGAGGG - Intronic
1032655795 7:133928519-133928541 AAGGTGAGTATGAAAGAGGATGG - Intronic
1033068070 7:138175349-138175371 ATGGAGAAAAGGAGAAAGGAAGG + Intergenic
1033134951 7:138776553-138776575 AGGGTGAAGTGGAGAGTGGAGGG - Intronic
1033148039 7:138887958-138887980 AAGGAGAACAGGGAAGAGGACGG + Intronic
1033189001 7:139259303-139259325 AAGCGGAAGCGGAAAGAGGAAGG + Exonic
1033465536 7:141585962-141585984 ATGGTGTAGTGGAAAGAACATGG + Intronic
1033559927 7:142521528-142521550 ATGGTGGAGAGGTAAGTGGAGGG + Intergenic
1033740840 7:144274685-144274707 AAGGGGATGAGGAAAGAGGGGGG - Intergenic
1033753066 7:144374928-144374950 AAGGGGATGAGGAAAGAGGGGGG + Intronic
1033804387 7:144937580-144937602 AAGGGGAAGCGGAAAGAGAAGGG - Intergenic
1033840237 7:145364400-145364422 GTGGTGAGGAGTAAAGAGGGAGG + Intergenic
1033912738 7:146285669-146285691 AGGGAGATGAGGGAAGAGGAGGG - Intronic
1034392190 7:150795305-150795327 ATGGTTAAGAGTAAAGGGAATGG - Intronic
1034636643 7:152572565-152572587 ATGGGGAGGAGGAAAGCGGGAGG - Intergenic
1034713847 7:153220994-153221016 AGGCTGGAGAGGAAAGAGGGAGG - Intergenic
1035483804 7:159206843-159206865 ATGGTGCAAAGGAGAGAGGTGGG + Intergenic
1035483827 7:159206968-159206990 ATGGTGCAAAGGAGAGAGGTGGG + Intergenic
1035483840 7:159207030-159207052 ATGGTGCAAAGGAGAGAGGGAGG + Intergenic
1035494309 7:159309360-159309382 ATGGTGGAAGGCAAAGAGGAAGG + Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035570570 8:669980-670002 CAGGTGGAGAGGAGAGAGGACGG - Intronic
1035702694 8:1648723-1648745 AGGGAGAGGAGGAAAGAGGCCGG - Intronic
1035911147 8:3567525-3567547 ATGGGGGAGGGGAAAGAGAAAGG + Intronic
1035927458 8:3743886-3743908 ATGGTGCAGAGGAAAAGGCAGGG - Intronic
1036130398 8:6104263-6104285 ATGGAGAGGAGGGGAGAGGAAGG + Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036487229 8:9190218-9190240 ATGGGAGGGAGGAAAGAGGAAGG - Intergenic
1036556537 8:9864891-9864913 ATGGAGTAGAGCAGAGAGGAAGG - Intergenic
1036643782 8:10599870-10599892 ATGGTGAAGAGGGAATAGTCAGG - Intergenic
1036755627 8:11468931-11468953 GTGGGCCAGAGGAAAGAGGAAGG + Intronic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037485479 8:19342848-19342870 ATGGAGAAAGGGAAAGAGGAGGG + Intronic
1037753453 8:21697079-21697101 ATGGGACAGAGGAAAGGGGAAGG + Intronic
1037806233 8:22059148-22059170 AGGGTGAAAGGGAAAGAGGGAGG + Intronic
1037838723 8:22229554-22229576 ATGGGGAAGAGCAAAGGGAAGGG + Intronic
1038113393 8:24525158-24525180 TTTATGAAGAGGATAGAGGATGG - Intronic
1038346256 8:26735205-26735227 GGGGTGGAGAGCAAAGAGGAGGG + Intergenic
1039203969 8:35129012-35129034 ATGGGAAAGAGGAAAGAGCTTGG + Intergenic
1039308648 8:36292445-36292467 ATGGTGAAGATGATAGATGCAGG + Intergenic
1039458521 8:37724604-37724626 ATAGTGCAGAGAAAAGAGGAAGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1039998783 8:42559228-42559250 ATGTTTAAGATGATAGAGGAGGG - Intergenic
1040835227 8:51723955-51723977 GTGGAGAAGAGGAAATAAGATGG + Intronic
1040866467 8:52053391-52053413 ATAGTGGGGAGGCAAGAGGATGG - Intergenic
1041433561 8:57811632-57811654 CTGGAGAAGGGCAAAGAGGAAGG + Intergenic
1041560947 8:59216569-59216591 AAGTTGAAGAGGGAAGAGGCTGG - Intergenic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042343108 8:67701091-67701113 ATGGTATAGTGGAAAGAGCATGG + Intronic
1042360388 8:67876323-67876345 AGGGTAGAGAGGAAAGAGGAGGG + Intergenic
1042837397 8:73091088-73091110 ATGGTGAACAGGACAGATGCTGG - Intronic
1043052080 8:75396739-75396761 GTGGTGAGAAGGAAAGAGGAGGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043543399 8:81288477-81288499 ATGGTGAACAAGATAGAGTAGGG + Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1043934774 8:86130785-86130807 ATGGGGAAGAGGACAGAGGCAGG - Intronic
1044265770 8:90179407-90179429 AGGTTGAATAGGAGAGAGGAGGG + Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044740850 8:95324663-95324685 ATTGTAAAGGGGAAAGAGGGAGG - Intergenic
1045225793 8:100244480-100244502 CTGGTGATGAGTCAAGAGGAGGG - Intronic
1045345753 8:101292091-101292113 ATGGAGCAGAGACAAGAGGATGG + Intergenic
1045384340 8:101656957-101656979 AAGGTGAAGAGGCTAGAGAAAGG + Intronic
1045487163 8:102640564-102640586 AGGGAGAGAAGGAAAGAGGAAGG + Intergenic
1046103143 8:109637346-109637368 ATGGTGAAAAGTAAACATGATGG - Intronic
1046305798 8:112365210-112365232 ATATTGAAGAGGAAGGAGGCAGG - Intronic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046974026 8:120253358-120253380 AGGGAGCAGAGAAAAGAGGATGG - Intronic
1047113788 8:121818524-121818546 ATGGGGAGCAGGAAAGGGGATGG - Intergenic
1047148773 8:122237061-122237083 ATCATGAATAGGAAAGTGGATGG + Intergenic
1047216094 8:122877085-122877107 ATAGTAAAGTGGAGAGAGGATGG + Intronic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047695546 8:127400296-127400318 AGGTTGAATAGTAAAGAGGAGGG + Intergenic
1048254549 8:132895934-132895956 AGCTTGTAGAGGAAAGAGGAAGG + Intronic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1048792325 8:138115236-138115258 AAGATGAAGAGGAAGTAGGAGGG + Intergenic
1048805098 8:138232939-138232961 GTGGTGAAGAGGAAAGTGGGAGG - Intronic
1048827151 8:138439392-138439414 ATGGTGTAGTGGAATGAGAATGG - Intronic
1048938910 8:139379820-139379842 AAGGTGAAGATGAAAGATAATGG + Intergenic
1048970774 8:139643866-139643888 ATGGTGCAGAGGAAGGGGGCTGG - Intronic
1049056756 8:140242945-140242967 AAAGTGAAGGGGAAAGAGTAAGG + Intronic
1049070383 8:140351066-140351088 AAGGTGCAGAGGGGAGAGGATGG + Intronic
1049225109 8:141446826-141446848 CTGGTGCAGAGGGAAGATGAAGG + Intergenic
1049469240 8:142768140-142768162 GGGGAGAAGAGGAGAGAGGAAGG + Intronic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050010425 9:1180316-1180338 AAGGAGAAGAGGAAGCAGGAAGG - Intergenic
1050073874 9:1843740-1843762 ATGGTGAAGAGCAGAGAGAGAGG - Intergenic
1050163219 9:2739233-2739255 ATGAGGAACAGCAAAGAGGAAGG + Intronic
1050396671 9:5205170-5205192 GTGATCAAGAGGAAAGTGGAGGG - Intergenic
1050496055 9:6243724-6243746 TTGGTGAACAGGAAAGAAAATGG + Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050831083 9:10014321-10014343 ATGGAGAAGTGGAAAGAATATGG - Intronic
1050968930 9:11844328-11844350 AGGTTGAAGAGAAAAGAGAAAGG + Intergenic
1051109988 9:13624920-13624942 AAAGTGATGAAGAAAGAGGAGGG + Intergenic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051754713 9:20386314-20386336 ATGTTGAAGAGTAAGGAGAAGGG + Intronic
1051771828 9:20587486-20587508 ATTGTGAAGTGGAAAGAGTAGGG - Intronic
1051983800 9:23057633-23057655 ATGAGGAGCAGGAAAGAGGATGG - Intergenic
1052078558 9:24175110-24175132 ATGATGCAGTGGAAAGAGCATGG + Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052223315 9:26054197-26054219 ATGGTGAAGATGGAGGTGGAGGG - Intergenic
1052395638 9:27934809-27934831 ATGGCAGAGTGGAAAGAGGATGG + Intergenic
1052568483 9:30189516-30189538 ATGCTGAAGAGGAACCAGGTTGG - Intergenic
1052820169 9:33132213-33132235 GTTGTGAAGTGGGAAGAGGAGGG + Intronic
1052860960 9:33437358-33437380 AAAATCAAGAGGAAAGAGGAAGG + Intergenic
1053095595 9:35325250-35325272 GTTGTGAAGAGGAATGAGGGGGG + Intronic
1053113574 9:35482539-35482561 ATGGGGAAGGGAAAAGAAGATGG + Intergenic
1053143878 9:35698996-35699018 ATGGTGAGGGTGGAAGAGGAAGG + Intronic
1053437303 9:38084554-38084576 ATGGGGATTAGGAAGGAGGAAGG + Intergenic
1053537149 9:38937408-38937430 ATTATGAAGAGGAAACAGCAGGG + Intergenic
1054628986 9:67426522-67426544 ATTATGAAGAGGAAACAGCAGGG - Intergenic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054896850 9:70323076-70323098 ATGGTGTAGTGGAAAGAACATGG + Intronic
1056834734 9:89945231-89945253 AAGGTGAATGGGGAAGAGGAAGG - Intergenic
1056893933 9:90523305-90523327 ATGGAACAGAGGAAAGAGGCTGG - Intergenic
1057745233 9:97745855-97745877 TGGGTGAAGAGGAAAGAGGGAGG - Intergenic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058270091 9:102961428-102961450 ATGGTTAAGAGGAAAGTGAAGGG - Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058536251 9:105963337-105963359 ATGGTGCAGTGAAAAGAGCAAGG - Intergenic
1058561429 9:106233118-106233140 AGGAGGAGGAGGAAAGAGGAAGG - Intergenic
1058628287 9:106958812-106958834 ATGGTGAAGGGTAGAAAGGATGG + Intronic
1058752154 9:108050226-108050248 TTACTGAAGGGGAAAGAGGAAGG + Intergenic
1058764341 9:108166709-108166731 ATGGTTCAGGGGAAAGAGAATGG - Intergenic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059226118 9:112674768-112674790 AAGGAGGAGAGGAAAGAGGGGGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059510184 9:114837897-114837919 TTGGTGAAGAAGAAAGATGAGGG - Intergenic
1059721765 9:116966785-116966807 ATGGGGAAGGGGAAAGAGTGTGG - Intronic
1059756045 9:117294403-117294425 TTGTTGAAGAGGAGAGAGGAGGG + Intronic
1059929361 9:119245664-119245686 TTTAGGAAGAGGAAAGAGGAAGG - Intronic
1060031178 9:120216334-120216356 ATGGTGAAGAAGGCAGAGAATGG + Intergenic
1060190354 9:121588602-121588624 ATGGGGAAGAGGGAAGGGAAGGG + Intronic
1060203914 9:121670658-121670680 AATGTGATGAGGAAAGAGGCAGG - Intronic
1060254447 9:122014805-122014827 ATGATGTAGTGGAAAGATGACGG + Intronic
1060404137 9:123364770-123364792 ATGGTGAAGAGGAAGGGAGATGG - Intronic
1060429638 9:123539537-123539559 ATGGAGAAAAGGAAAGAGTTGGG + Intronic
1061513815 9:131076852-131076874 ATGGTGAAGAGGAAAATGCCCGG - Intronic
1061660334 9:132125903-132125925 ATGGAGAAGAGAACACAGGAGGG - Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061740537 9:132701333-132701355 ATGGTTAACAGGAAAAAGGTTGG + Intergenic
1061912910 9:133734305-133734327 ATGGGGAAGTGGCAAGAGGAAGG - Intronic
1062090859 9:134678140-134678162 ATGGTGCAGAGGAAAGATTTTGG + Intronic
1062314580 9:135960516-135960538 AAGGGGAAGAGGAAGGAGAAGGG + Intronic
1062632358 9:137469827-137469849 ATGATGAACAGGAAAGAAAATGG + Intronic
1185640654 X:1588149-1588171 AGGGAGCAGAGGAAAGGGGAGGG - Intergenic
1186014352 X:5174402-5174424 ATGGTGTAAGGGAAAGGGGAAGG + Intergenic
1186236179 X:7513421-7513443 ATGGACAAGAGGAAACATGACGG + Intergenic
1186619526 X:11224180-11224202 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186619530 X:11224242-11224264 AAGATGAAGAAGAAAGAAGAAGG + Intronic
1186639197 X:11437090-11437112 AGGGAGAAAGGGAAAGAGGAAGG + Intronic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188355332 X:29183652-29183674 GGAGTGAAGAGGAGAGAGGAGGG - Intronic
1188565314 X:31520402-31520424 ATGGTGGAAAGCAAAGGGGAAGG - Intronic
1188961711 X:36500979-36501001 AGGGTGAAGAGGGAAGAGGCAGG - Intergenic
1189110596 X:38286083-38286105 AGGGGGAAGAGGAAGGAGAAGGG - Exonic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189926701 X:45962025-45962047 ATGGTAAACAGAAAAAAGGAGGG + Intergenic
1190154090 X:47973655-47973677 GTGGTGAACAGGGAAGAGTAGGG - Intronic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190654163 X:52596551-52596573 TTGGTGCAGAGGAAATAGCAGGG - Intergenic
1190732075 X:53233063-53233085 ATGGTGGAGAGGGGAGAGGGAGG + Exonic
1190862335 X:54357265-54357287 AAGGTGAGGAGGATACAGGAGGG - Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1191880639 X:65841205-65841227 ATGGGTATGAGGGAAGAGGATGG + Intergenic
1192003543 X:67183506-67183528 ATGGTAAAGAGCAAAGGTGATGG - Intergenic
1192089723 X:68140920-68140942 ATGGGGAATTGGAAAGGGGATGG - Intronic
1192195932 X:69028160-69028182 GTGGTGTAGAGGAAGGAGAAAGG + Intergenic
1192282616 X:69701517-69701539 ATCGTGATGAGGAAAGTGAAAGG - Intronic
1192326050 X:70133353-70133375 GGGGTGAAGGGGGAAGAGGACGG + Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192447411 X:71221474-71221496 ATGCTGTAGAGGAAAGGGGTGGG - Intronic
1192671184 X:73143717-73143739 ATGGTGATGAGGAAGGCGGGAGG - Intergenic
1192804358 X:74496146-74496168 ATGGTGAAGAGGAGAGCCTAAGG + Intronic
1192880770 X:75281299-75281321 ATGTTGAAGAGGAATGGTGAGGG + Intronic
1193137511 X:77988635-77988657 GTGCTGAAGATGAAAGTGGAAGG + Exonic
1193228688 X:79016406-79016428 ATGTTGAAGAGGAATGGTGAGGG - Intergenic
1193444383 X:81581970-81581992 ATGGTGAATAGGAGTGATGAGGG - Intergenic
1193492171 X:82163225-82163247 ATGTTGAAAGGCAAAGAGGAAGG - Intergenic
1193934032 X:87593125-87593147 ATGTTGAAAAGTAAAGAGAAAGG - Intronic
1194736982 X:97524050-97524072 ATGGTAAGGAGCAAAGAGGAGGG - Intronic
1195013469 X:100755574-100755596 ATGGGGAAGAGGTATGTGGATGG - Intergenic
1195777834 X:108427233-108427255 AAGGGGAAGAGGAAAGAGAGAGG - Intronic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196047450 X:111271046-111271068 ATTGTTAAGAGGAAAGTGAATGG + Intergenic
1196205205 X:112931519-112931541 ATGGTGAACAAGAAAGAAGATGG - Intergenic
1196377015 X:115044594-115044616 ATGGTGCAGAGAAAGGAAGATGG + Intergenic
1196545042 X:116952843-116952865 ATGGTGTAGTGGAAAGATGATGG + Intergenic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1197317381 X:124984148-124984170 ATTCTGAAGAGGTAAGAGAAAGG - Intergenic
1197591956 X:128420012-128420034 ATGGGGAAGAGGTATGTGGATGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198029488 X:132741262-132741284 ATGGTGTAGAAGAAACAGCACGG + Intronic
1198229146 X:134673191-134673213 AGGAAGAAGAGGAAAGAGGGAGG + Intronic
1198434590 X:136603833-136603855 ATGGTGAGGTGGACAGAGGAGGG - Intergenic
1199381355 X:147176322-147176344 ATGCTGGAGGGGAAAGAGGAAGG + Intergenic
1199575688 X:149311748-149311770 ATGGGGAACTGGAAAGGGGATGG + Intergenic
1199860428 X:151796432-151796454 GTGAAGAAGAGGAAAGAGGAAGG - Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200972369 Y:9166826-9166848 ATTGTAGTGAGGAAAGAGGATGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201892149 Y:18954278-18954300 AGGGTGAACAGGAAGAAGGATGG + Intergenic
1202017426 Y:20425256-20425278 AGGGCTGAGAGGAAAGAGGAGGG + Intergenic
1202133684 Y:21638187-21638209 ATTGTGGTGAGGAAAGAGGATGG - Intergenic
1202138653 Y:21697456-21697478 ATTGTAGTGAGGAAAGAGGATGG + Intergenic
1202164940 Y:21977697-21977719 ATTATGAAGAGAAAAAAGGATGG + Intergenic
1202226416 Y:22608677-22608699 ATTATGAAGAGAAAAAAGGATGG - Intergenic
1202316700 Y:23586987-23587009 ATTATGAAGAGAAAAAAGGATGG + Intergenic
1202554064 Y:26083071-26083093 ATTATGAAGAGAAAAAAGGATGG - Intergenic