ID: 1197997492

View in Genome Browser
Species Human (GRCh38)
Location X:132393999-132394021
Sequence CTAAGGTAGAATGCTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197997492_1197997498 4 Left 1197997492 X:132393999-132394021 CCCCCATTAGCATTCTACCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1197997498 X:132394026-132394048 GTTTATCAAATTAGCTGATTGGG 0: 1
1: 0
2: 0
3: 10
4: 168
1197997492_1197997500 16 Left 1197997492 X:132393999-132394021 CCCCCATTAGCATTCTACCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1197997500 X:132394038-132394060 AGCTGATTGGGACATTAGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 270
1197997492_1197997499 12 Left 1197997492 X:132393999-132394021 CCCCCATTAGCATTCTACCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1197997499 X:132394034-132394056 AATTAGCTGATTGGGACATTAGG 0: 1
1: 0
2: 0
3: 13
4: 165
1197997492_1197997501 17 Left 1197997492 X:132393999-132394021 CCCCCATTAGCATTCTACCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1197997501 X:132394039-132394061 GCTGATTGGGACATTAGGAAGGG 0: 1
1: 0
2: 0
3: 10
4: 115
1197997492_1197997497 3 Left 1197997492 X:132393999-132394021 CCCCCATTAGCATTCTACCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1197997497 X:132394025-132394047 AGTTTATCAAATTAGCTGATTGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197997492 Original CRISPR CTAAGGTAGAATGCTAATGG GGG (reversed) Intronic
901426737 1:9186576-9186598 GTAAGGAAGAATGCGAATGGTGG - Intergenic
909091770 1:71234756-71234778 CTAAGCTAGTATGCTGAGGGAGG + Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
915559118 1:156676294-156676316 CTAGTGTAGGATGCGAATGGTGG - Intronic
915951421 1:160192105-160192127 CTAAGCTGGAAGGCTTATGGGGG + Intronic
917113877 1:171581770-171581792 CTAAGGAAGAATGCTAGTCTAGG - Intronic
1063665235 10:8056681-8056703 CTTAGGTGGGAGGCTAATGGAGG - Intronic
1063804824 10:9626792-9626814 GTAAGGAAGAATCTTAATGGCGG - Intergenic
1064483057 10:15758818-15758840 GTAAGTTAGAATGCTACTGCAGG - Intergenic
1064934066 10:20660584-20660606 TGAAGGTAGAATGCTTATGATGG + Intergenic
1066082315 10:31943710-31943732 CAGAGCTAGAATGCTAATTGGGG - Intergenic
1068321206 10:55419169-55419191 CTAAGGTAGAAAGCGAAATGGGG + Intronic
1069530331 10:69213486-69213508 CTAATGTAAGATGTTAATGGGGG - Intergenic
1070169813 10:73924522-73924544 CTAAGGGAGAAAGCTTAGGGTGG - Intergenic
1072617897 10:97061867-97061889 CGAAGTTAGAATGCTGGTGGGGG - Intronic
1075695308 10:124430306-124430328 CTAAAGTAGAAGGCTAAAGTGGG - Intergenic
1079193634 11:18304081-18304103 CAAAGGAAGAATGCTAAAGGAGG + Intronic
1080424071 11:32140114-32140136 CTGGGGTAGAATGGCAATGGTGG - Intergenic
1080841692 11:35989697-35989719 CTCAGCTAGAATGTTATTGGTGG + Intronic
1081261203 11:40963640-40963662 CTAAAGTTCAATGCTAAAGGAGG - Intronic
1086030688 11:82351539-82351561 CCAAGGTAGAATGTGAATTGTGG - Intergenic
1087829698 11:102806040-102806062 CAAAGGGAGAAAGGTAATGGAGG - Intergenic
1089182294 11:116591306-116591328 CCAAGGTAAAATGCTGAGGGAGG + Intergenic
1090817014 11:130307121-130307143 CTACAGTAGAATGTTAATGGTGG - Intronic
1096899733 12:54863869-54863891 CTAAGGTAGAATTCTAAGATAGG - Intergenic
1102657910 12:114498666-114498688 CTTAGGTCAAATGTTAATGGGGG + Intergenic
1103367470 12:120393755-120393777 CCCAGGCTGAATGCTAATGGAGG - Intergenic
1104407367 12:128529257-128529279 CTAGGCAAGAATGCTGATGGGGG - Intronic
1108415288 13:50192272-50192294 CTAAGGCAGAATGCTACCAGGGG - Intronic
1109586458 13:64411053-64411075 CAAAGGTACAATGCTAATTTGGG + Intergenic
1109940252 13:69352646-69352668 CTAAGGTGAAATGCTAACAGAGG + Intergenic
1110102773 13:71630943-71630965 CACAGGTAGAAGGCTAATAGTGG + Intronic
1111377423 13:87398955-87398977 CTTAGGTAGAATGAGAATGATGG - Intergenic
1114785845 14:25597554-25597576 CTAAGATAGTATATTAATGGGGG + Intergenic
1115596217 14:34912099-34912121 GTAGGTTAAAATGCTAATGGAGG + Intergenic
1116603964 14:46965382-46965404 GTAAGGAAGAATGATAATGTTGG + Intronic
1124115074 15:26833651-26833673 CTAAGGTGGTCTGCTAAGGGTGG + Intronic
1124842999 15:33262122-33262144 CTAAGGTAAAATGGTAATTCTGG + Intergenic
1126671384 15:51118494-51118516 CTAAGCCAGACTGCAAATGGGGG - Intergenic
1134823461 16:17265617-17265639 CCAAGGTTGAATGGGAATGGAGG - Intronic
1139044287 16:63037997-63038019 CTAATATGGAATGCTACTGGAGG + Intergenic
1141233351 16:82192372-82192394 CTGAGGTAGACTCCTAATGGAGG + Intergenic
1156019217 18:32580584-32580606 AAAAGGTAGAATGGTAATAGAGG + Intergenic
1160085238 18:75771341-75771363 CAAAGGTAGAAGGGTAATGCAGG - Intergenic
926537458 2:14130850-14130872 CTATTGTACAATTCTAATGGGGG + Intergenic
930097955 2:47581355-47581377 CTTATGAAGAATGCTAAGGGTGG - Intergenic
933628891 2:84634015-84634037 CTACAGCAGAATCCTAATGGTGG - Intronic
935219901 2:101003100-101003122 CTAAGATAGAAGGCCGATGGAGG - Intronic
939792391 2:146594185-146594207 CAAAGGGAGAATGCTAATAAAGG + Intergenic
943644896 2:190399712-190399734 CTATGGTAGAATGCTAACACTGG + Intergenic
948145072 2:235702544-235702566 CTGAGGTAGAATGCTAAGATAGG + Intronic
1169329432 20:4704902-4704924 CTATGGGTGAATGCCAATGGAGG + Intergenic
1172328841 20:34059654-34059676 CTAAGTTAAAATAGTAATGGGGG - Intronic
1173362283 20:42355421-42355443 CTAAGGAAAAATGCTCGTGGAGG + Intronic
1181495409 22:23284753-23284775 CTAAGGTTGAAGGCTCATGTGGG - Intronic
1183647177 22:39133599-39133621 CTAGAGGAGAATGATAATGGTGG + Exonic
949160964 3:881321-881343 CTAATGTACAATGTTAATAGGGG - Intergenic
952532201 3:34274229-34274251 CTAAGATTAAATGCTGATGGTGG + Intergenic
959050567 3:101520725-101520747 CTAAGGCAAAATTCAAATGGTGG - Intergenic
961175803 3:124834281-124834303 CTGATGTGGAATGCTGATGGTGG + Intronic
961862842 3:129931296-129931318 CTAAGGTAGTGTGGTAATGCTGG - Intergenic
962832671 3:139158147-139158169 CCAACGTAGAAGGCCAATGGAGG + Intronic
964046655 3:152336399-152336421 CTATGGCAGAATCCAAATGGAGG - Intronic
969466734 4:7361787-7361809 CGCAGGTGGAATGCTAATGCCGG + Intronic
970801960 4:19982949-19982971 GAAAGGTAAAATGCTAATGCTGG + Intergenic
978255948 4:106693093-106693115 CTAAGGTAAAATAGTGATGGTGG - Intergenic
979300617 4:119082251-119082273 CTAAGGAAGCATGCTGCTGGAGG - Intergenic
984106384 4:175552475-175552497 ATGAGGCAGAATGCTATTGGAGG - Intergenic
984849991 4:184144612-184144634 CTAAGGTAGGAGGCAAAGGGAGG + Intronic
993173590 5:84452624-84452646 CTGAGGTTGAATGGTAATGCTGG - Intergenic
993679701 5:90860737-90860759 CTAAGCTAAAAAGCTAATAGTGG + Intronic
994483396 5:100363952-100363974 CTATGATATAATTCTAATGGGGG + Intergenic
995267431 5:110179468-110179490 CTAAGCAAGAATGCTCAAGGAGG + Intergenic
995933194 5:117476201-117476223 CTAAGATAGAATGGTAATCTGGG - Intergenic
1000967132 5:167671068-167671090 CTAAGGCTGAATTCAAATGGTGG - Intronic
1003017918 6:2482855-2482877 CTAATATAGAATGCTTTTGGTGG + Intergenic
1003770448 6:9293168-9293190 CTAAGGAAGAATAATAATGAAGG + Intergenic
1005374912 6:25172490-25172512 CTCAGGAAGAATGCTTTTGGTGG - Intergenic
1006882346 6:37351336-37351358 CTGGGGTAGAATGCTAAGGTGGG + Intergenic
1014311326 6:119805647-119805669 CTAAGGAATAATGCCCATGGAGG + Intergenic
1017404988 6:154109625-154109647 CTAAAGTGAAATGCTAATGGTGG + Intronic
1018076756 6:160223459-160223481 CCAAGATATATTGCTAATGGGGG - Intronic
1020445015 7:8259869-8259891 CTGAGGCAGATTGCGAATGGTGG + Intronic
1022708916 7:32833633-32833655 CTAAGGGAGAAGGAGAATGGAGG - Intergenic
1028937667 7:96484451-96484473 ATAAGGTAAAATGCTAAGTGTGG + Intronic
1029973424 7:104811501-104811523 CTAAGTGAGATTCCTAATGGAGG + Intronic
1033125525 7:138703831-138703853 CTAAGACAGCATGCAAATGGAGG - Intergenic
1037317010 8:17608654-17608676 CTAAGTCAGAATGCTTATGAGGG + Intronic
1037654860 8:20874273-20874295 CTAGTGTAGAATGGGAATGGGGG + Intergenic
1039050319 8:33486590-33486612 CTAAGGTAGTAATTTAATGGTGG + Intronic
1040672360 8:49706894-49706916 CTAAAGTAGAATGCCCAGGGGGG - Intergenic
1047434113 8:124820864-124820886 CCAAGGTAGTATGATATTGGTGG - Intergenic
1047445792 8:124918163-124918185 CTGAGAAAGAATGCTAATGCTGG + Intergenic
1053035962 9:34826948-34826970 CTTATGTGGAATGCTGATGGTGG - Intergenic
1055126245 9:72720996-72721018 GTAATGTAAAATGCAAATGGGGG + Intronic
1055573338 9:77639226-77639248 CTATGGTAGAAAGCTAAGGCTGG + Intronic
1188071532 X:25724337-25724359 CTAAGGTAGAATACCAAGGTGGG + Intergenic
1189127301 X:38462003-38462025 CTGAGGTTGCATGCTGATGGTGG + Intronic
1197769565 X:130081633-130081655 CTAAGGCAGACTGCCAATAGAGG + Intronic
1197909780 X:131468783-131468805 CTAATGCAAAATGCTAATAGGGG - Intergenic
1197988606 X:132293724-132293746 CTAAGAAAAAATGCTAATGTAGG + Intergenic
1197997492 X:132393999-132394021 CTAAGGTAGAATGCTAATGGGGG - Intronic
1199095757 X:143736419-143736441 CTGAGGTTGAATGGTAATGCTGG - Intergenic
1199118818 X:144026261-144026283 GAAAGCTAGAATGCTAATGGTGG + Intergenic