ID: 1198000743

View in Genome Browser
Species Human (GRCh38)
Location X:132433282-132433304
Sequence CCTGACAAGCTGTTATGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198000738_1198000743 23 Left 1198000738 X:132433236-132433258 CCCTAACAATGAATCAGTCATCA 0: 1
1: 0
2: 0
3: 24
4: 175
Right 1198000743 X:132433282-132433304 CCTGACAAGCTGTTATGGCATGG 0: 1
1: 0
2: 2
3: 9
4: 117
1198000739_1198000743 22 Left 1198000739 X:132433237-132433259 CCTAACAATGAATCAGTCATCAA 0: 1
1: 0
2: 2
3: 16
4: 266
Right 1198000743 X:132433282-132433304 CCTGACAAGCTGTTATGGCATGG 0: 1
1: 0
2: 2
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198000743 Original CRISPR CCTGACAAGCTGTTATGGCA TGG Intronic
903624149 1:24719309-24719331 CCTGGGAATCTGTTAGGGCATGG - Intergenic
904632890 1:31856312-31856334 CCTGACAAGCTCTTGCCGCAGGG - Intergenic
913933053 1:125003794-125003816 TCTGTCAAGCTTTTATGGGAAGG - Intergenic
915868162 1:159528183-159528205 CCTGACAAGCTAAGGTGGCATGG + Intergenic
915903166 1:159860815-159860837 CCTGGCAGGCTCCTATGGCATGG - Intronic
1065380649 10:25086769-25086791 TCTGACAAGCTTTTATGGGTAGG - Intergenic
1065521053 10:26573171-26573193 ACTAACAAGCAGTTATAGCAAGG - Intergenic
1066162477 10:32748410-32748432 TCAGACTAGCAGTTATGGCAAGG - Intronic
1072205500 10:93201320-93201342 CCTGAGAAACTGTTAGGGCCTGG - Intergenic
1072631150 10:97147520-97147542 ACTGAGAAGCTGTGATGGGAAGG + Intronic
1077138131 11:1011718-1011740 CCTGACATGCTGTGGAGGCAGGG + Exonic
1077597904 11:3550211-3550233 CCTGACTAACTTCTATGGCATGG - Intergenic
1078405859 11:11069441-11069463 CCTGAAAGGCTGTCATGGGAAGG - Intergenic
1084253992 11:67926123-67926145 CCTGACTAACTTCTATGGCATGG - Intergenic
1084818886 11:71669806-71669828 CCTGACTAACTTCTATGGCATGG + Intergenic
1088133374 11:106523353-106523375 CCTGAGAACATGTTATGGCTTGG - Intergenic
1091755998 12:3052072-3052094 CCTGACAAGATTTTGTGGTAGGG + Intergenic
1092424065 12:8359526-8359548 CCTGACTAACTTCTATGGCATGG - Intergenic
1095484805 12:42673869-42673891 GCTCACAAGCTGTTAGGGAATGG + Intergenic
1095909719 12:47414012-47414034 CCTGACAAGCTCACATGGCATGG - Intergenic
1097891549 12:64781590-64781612 CCTGAACAGCTGTTAGGACAGGG + Intronic
1099741039 12:86634678-86634700 CCTGACAAGGCTTCATGGCAGGG - Intronic
1100030500 12:90183527-90183549 ACTAATAAGCTGTTATAGCAAGG + Intergenic
1100121474 12:91373819-91373841 CCTGTCAACCCATTATGGCAGGG - Intergenic
1101909881 12:108853476-108853498 CCTGGAAAGCTGTGATGGCTGGG + Intronic
1102740033 12:115199000-115199022 TCTGACAAGCTGGAAAGGCAGGG - Intergenic
1107633200 13:42364040-42364062 CCTGAGTAGCTGTCATGACATGG - Intergenic
1109345316 13:61109008-61109030 CCTGAACAGCTGTTTTGGGAAGG - Intergenic
1111380728 13:87447225-87447247 CCTGATCAGCTGTCATGTCAAGG + Intergenic
1115076151 14:29393135-29393157 CCTGGAAATCTATTATGGCAAGG + Intergenic
1116952055 14:50887676-50887698 CCTGAAAGGCAGTTATGGTAGGG + Intronic
1117371770 14:55085292-55085314 CCTGACAAACCAGTATGGCATGG - Intergenic
1121649358 14:95545770-95545792 CCTCACTAGATGTGATGGCAAGG - Intergenic
1122417349 14:101556766-101556788 CCTGACAAGCTGTCCTGGCTGGG + Intergenic
1124175842 15:27423176-27423198 CCTGACAAGCTGGAATGGCATGG + Intronic
1125685348 15:41560175-41560197 CCTGAGAGGCTGATATGGCAAGG - Intronic
1127351555 15:58157913-58157935 CCTGAGAAGCTTTGATGACAAGG + Intronic
1129575755 15:76743428-76743450 ACTGATAAGCTGTTCTGGCAAGG + Intronic
1130807797 15:87344801-87344823 CCTGGAAAGCTGTTCTGCCATGG + Intergenic
1133374207 16:5270460-5270482 CCTGACTAACTTCTATGGCATGG + Intergenic
1135024032 16:18985462-18985484 CTTGACTAGCTGTTATTGAAAGG - Intronic
1135316023 16:21445023-21445045 CTTGACTAGCTGTTATTGAAAGG + Intronic
1135368948 16:21877285-21877307 CTTGACTAGCTGTTATTGAAAGG + Intronic
1135442868 16:22493858-22493880 CTTGACTAGCTGTTATTGAAAGG - Intronic
1136117119 16:28101505-28101527 CCTGACCAGCTGTGATGGTGTGG - Exonic
1136312699 16:29423762-29423784 CTTGACTAGCTGTTATTGAAAGG + Intergenic
1136326133 16:29525508-29525530 CTTGACTAGCTGTTATTGAAAGG + Intergenic
1136440822 16:30265492-30265514 CTTGACTAGCTGTTATTGAAAGG + Intergenic
1139887337 16:70217809-70217831 CTTGACTAGCTGTTATTGAAAGG + Intergenic
1141858577 16:86701303-86701325 CCTCACAAGCTGGGAGGGCACGG + Intergenic
1146377538 17:32304679-32304701 CCTGACATGGTGCTATGTCAGGG - Intronic
1154558881 18:15798851-15798873 TCTGTCTAGCTGTTATGGGAAGG - Intergenic
1160043491 18:75366566-75366588 ACACACATGCTGTTATGGCAAGG - Intergenic
929330336 2:40674330-40674352 CCCTTCAAGCTGTAATGGCAGGG + Intergenic
930522293 2:52482651-52482673 CCTGAAAAGCCGATATGGCTTGG + Intergenic
931996241 2:67841950-67841972 CCTGACAACCTGACATGGAATGG - Intergenic
933275082 2:80275306-80275328 CCTGACAACATGTAATGACATGG - Intronic
938920189 2:135987720-135987742 CCTGAGAGGCTGTTATGGGATGG + Intergenic
939764220 2:146225911-146225933 TCTGACATGCTGTTCTGTCAAGG - Intergenic
939968492 2:148634757-148634779 CCCAACAAGCTGTTCTTGCAGGG + Intergenic
940802134 2:158144793-158144815 CCTGGCAAGCTGTTTTTGCCTGG + Intergenic
945971171 2:216233688-216233710 CCTGAGAAGCAGTTATGGTATGG + Intergenic
948500597 2:238390440-238390462 CCTAACAAGCTGTCATGTCCAGG - Intronic
948980499 2:241492048-241492070 GCTGACAACCTTCTATGGCAGGG - Intronic
1168786650 20:545129-545151 GCTGACAAACTGTGAAGGCAGGG - Intergenic
1173193409 20:40894239-40894261 CCTGAGAGGCAGGTATGGCAGGG + Intergenic
1173322510 20:42001119-42001141 CCTGGGAAGCTGGTGTGGCATGG + Intergenic
1180606272 22:17061368-17061390 CCTGAAAAGGTGTTATCGAAGGG - Intergenic
950752545 3:15141666-15141688 CCTGACTAACTTCTATGGCATGG + Intergenic
951476711 3:23114163-23114185 CCTGACAGGTTGTTCTTGCACGG - Intergenic
952410584 3:33046558-33046580 CCTCACAAGCAGTAATGGCAGGG + Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
956326720 3:68060906-68060928 CCTGACAAGCTGGTTTGTGATGG - Intronic
957068064 3:75542621-75542643 CCTGACTAACTTCTATGGCATGG - Intergenic
961285096 3:125795392-125795414 CCTGACTAACTTCTATGGCATGG + Intergenic
962852742 3:139319934-139319956 CCTAACAAGGAGTTCTGGCAAGG - Intronic
966394416 3:179487468-179487490 CCTGCCATGCTGTCATGGCTGGG - Intergenic
969012416 4:4077183-4077205 CCTGACTAACTTCTATGGCATGG - Intergenic
969741438 4:9030572-9030594 CCTGACTAACTTCTATGGCATGG + Intergenic
969800800 4:9563457-9563479 CCTGACTAACTTCTATGGCATGG + Intergenic
976254727 4:83088157-83088179 ACTAATAAGCAGTTATGGCAAGG + Intergenic
981531927 4:145761794-145761816 GCTGACAAGCAGCTCTGGCAAGG + Intronic
983220834 4:165043080-165043102 ACTGTCAAGCTGTAATTGCAAGG + Intergenic
984565917 4:181329939-181329961 CTTGAAAAGCTGTTACGGAAAGG - Intergenic
989525816 5:42453247-42453269 CCTGTGAAGCTGGAATGGCAGGG + Intronic
1002979182 6:2117953-2117975 ACTGAGAAGCTGTGATGGCCTGG - Intronic
1004482527 6:16034448-16034470 CCTGACAAGTTGGTGTGGCATGG - Intergenic
1006976519 6:38107454-38107476 CCTGACAAGCCCACATGGCATGG - Intronic
1009411488 6:63370239-63370261 ACTGACAAGATGTGCTGGCATGG + Intergenic
1009485446 6:64216691-64216713 ACTGACAAGCTTTTCTGCCAAGG + Intronic
1009934744 6:70220579-70220601 CCTGACAATCTGCTATGTTAAGG - Intronic
1011915777 6:92504642-92504664 CCTGTCAAGTTTTTATTGCATGG - Intergenic
1013750531 6:113400584-113400606 CCTGACAAACTGGTGTGGGATGG - Intergenic
1015518256 6:134106105-134106127 CCTGACAAGCTGGTATAGCATGG - Intergenic
1015891307 6:137972300-137972322 CCAGGCAAGCTGTTCTGTCATGG - Intergenic
1015999912 6:139031613-139031635 CCTGGCAAGCTGTTCTCACATGG + Intronic
1017230321 6:152066744-152066766 CCTGACAACATGGTATAGCATGG + Intronic
1017718640 6:157229433-157229455 CCTGACAAGCTGTTGTGTGGTGG - Intergenic
1019637931 7:2086347-2086369 CCTGCCAAGTCCTTATGGCATGG + Intronic
1020813191 7:12871476-12871498 CCTGGCAAACTGTTTTGGGAAGG + Intergenic
1020920271 7:14254850-14254872 CCTTACAAGGTATTATGGAAGGG - Intronic
1023079557 7:36514368-36514390 CCTGGCAGGCTGTGAGGGCAGGG + Intronic
1024818402 7:53297920-53297942 CCTGACAAACTGATAGAGCAGGG + Intergenic
1027570930 7:79865693-79865715 TCTGACAATCTGTAATGGGAGGG - Intergenic
1028777493 7:94695509-94695531 CCTGACTAACTTTCATGGCATGG - Intergenic
1028808956 7:95061959-95061981 CCTGACAAGATGTTATATTAGGG + Intronic
1029071068 7:97898812-97898834 CCTGACTAACTTCTATGGCATGG - Intergenic
1029905571 7:104089888-104089910 GCTGAAAAGATGTTCTGGCAGGG - Intergenic
1036246650 8:7123158-7123180 CCTGACTAACTTCTATGGCATGG + Intergenic
1037165004 8:15816633-15816655 CATTACAAGCTTTTAGGGCAAGG + Intergenic
1037677402 8:21063581-21063603 CCTGGCATGCTGTATTGGCACGG + Intergenic
1038715362 8:29986449-29986471 CCTGCCAGGCTGTTGTGGGAGGG + Intergenic
1040600955 8:48883420-48883442 CTTGACCAGCTGATATGGCTTGG + Intergenic
1042297700 8:67239989-67240011 TCTGAGAAGCTGTTATAGAAGGG - Intronic
1048420805 8:134276568-134276590 CCTGGCAAGCTGCTATTGGAAGG - Intergenic
1052166803 9:25339924-25339946 CCTGGGAAGCTGGCATGGCATGG - Intergenic
1057611740 9:96550364-96550386 CCTGACAAATTGTTATTTCATGG + Intronic
1061732709 9:132628806-132628828 ACTGACAGGCTGTTATGGTGTGG + Intronic
1188043622 X:25399741-25399763 ACTGACAAGATCTTATGGCTCGG - Intergenic
1188394202 X:29660228-29660250 CCTGACAAGGTGATATGGTTTGG - Intronic
1189437051 X:41002199-41002221 CCTGACAAGCTGGTACAGCATGG - Intergenic
1190422850 X:50302765-50302787 ACTGACAACCTGCTATGACACGG - Intronic
1194607997 X:96005673-96005695 CCTGAGAAGCTGCTCTGCCAAGG - Intergenic
1196226326 X:113171864-113171886 CATTACAAGCTGCTATGTCAAGG - Intergenic
1197798830 X:130328117-130328139 CCTAACAAGATGCCATGGCATGG + Intergenic
1198000743 X:132433282-132433304 CCTGACAAGCTGTTATGGCATGG + Intronic
1198752942 X:139953496-139953518 CCTGACAAGCTGATGAGGCCTGG - Intergenic
1199856188 X:151760500-151760522 CCTGTCAAACTGATAGGGCAAGG + Intergenic
1201279399 Y:12328022-12328044 CCTGACATGCAGTTCTGTCAGGG - Intergenic