ID: 1198002234

View in Genome Browser
Species Human (GRCh38)
Location X:132451314-132451336
Sequence TCATCTATAAGCCCCTGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198002225_1198002234 15 Left 1198002225 X:132451276-132451298 CCTTCTGCCAGGTGCTCTGTCCC No data
Right 1198002234 X:132451314-132451336 TCATCTATAAGCCCCTGACTGGG No data
1198002231_1198002234 -5 Left 1198002231 X:132451296-132451318 CCCAGGGAGATGGGAGTTTCATC No data
Right 1198002234 X:132451314-132451336 TCATCTATAAGCCCCTGACTGGG No data
1198002232_1198002234 -6 Left 1198002232 X:132451297-132451319 CCAGGGAGATGGGAGTTTCATCT No data
Right 1198002234 X:132451314-132451336 TCATCTATAAGCCCCTGACTGGG No data
1198002222_1198002234 20 Left 1198002222 X:132451271-132451293 CCTCCCCTTCTGCCAGGTGCTCT No data
Right 1198002234 X:132451314-132451336 TCATCTATAAGCCCCTGACTGGG No data
1198002220_1198002234 27 Left 1198002220 X:132451264-132451286 CCTATAGCCTCCCCTTCTGCCAG No data
Right 1198002234 X:132451314-132451336 TCATCTATAAGCCCCTGACTGGG No data
1198002228_1198002234 8 Left 1198002228 X:132451283-132451305 CCAGGTGCTCTGTCCCAGGGAGA No data
Right 1198002234 X:132451314-132451336 TCATCTATAAGCCCCTGACTGGG No data
1198002224_1198002234 16 Left 1198002224 X:132451275-132451297 CCCTTCTGCCAGGTGCTCTGTCC No data
Right 1198002234 X:132451314-132451336 TCATCTATAAGCCCCTGACTGGG No data
1198002223_1198002234 17 Left 1198002223 X:132451274-132451296 CCCCTTCTGCCAGGTGCTCTGTC No data
Right 1198002234 X:132451314-132451336 TCATCTATAAGCCCCTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198002234 Original CRISPR TCATCTATAAGCCCCTGACT GGG Intronic