ID: 1198003699

View in Genome Browser
Species Human (GRCh38)
Location X:132469099-132469121
Sequence ATAGAGAAGAATACCGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198003699 Original CRISPR ATAGAGAAGAATACCGTGGA TGG Intronic
900545746 1:3228215-3228237 AAAGAGAAGCAAACCGAGGATGG + Intronic
900839283 1:5034770-5034792 ACAGAGCAAGATACCGTGGATGG + Intergenic
900935307 1:5762221-5762243 AAAAAGAAGAATAAAGTGGAAGG - Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
908600045 1:65728720-65728742 ATAAAGAAGAATCCTGTGAAAGG + Intergenic
910535673 1:88294811-88294833 AAAGAGGAGAATGCCGAGGAAGG - Intergenic
916961880 1:169896789-169896811 ATAAAGAAGTATTCCATGGAAGG + Intergenic
918805582 1:189037267-189037289 ATAGAAAAGATTACCATGAAAGG - Intergenic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1067321623 10:45226286-45226308 ACAGAGAAAAATACCCTGGAAGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1073846679 10:107564067-107564089 ATAGAGAAAAAAACCCCGGAAGG + Intergenic
1076594104 10:131614521-131614543 GTAGAGAGGAATACAGTGAAAGG + Intergenic
1076597534 10:131634290-131634312 ATAGAAAGTAAAACCGTGGATGG - Intergenic
1078420742 11:11210121-11210143 ATAGACAAGAAAACAGTGCAGGG + Intergenic
1078806235 11:14707952-14707974 ATGGAGAAGCATCCCTTGGAAGG + Intronic
1084598633 11:70132040-70132062 ACAGAGAAGAAGACCGTGGCGGG - Exonic
1086304129 11:85461317-85461339 AGAGAAAAGAATACAGTTGAGGG + Intronic
1086543135 11:87936615-87936637 ACAAAGAAGAATAAAGTGGAAGG - Intergenic
1087020608 11:93598968-93598990 AATCAGAAGTATACCGTGGAAGG - Intergenic
1088926392 11:114307510-114307532 ACAGAGAAGAATTGAGTGGAGGG - Intronic
1089281040 11:117374772-117374794 ATAGAGAAGAAAAACGCTGATGG - Intronic
1089638875 11:119833841-119833863 ATAGTCAAGAATTCCATGGAAGG - Intergenic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1099064975 12:77964512-77964534 ATTTACAAGAATACTGTGGATGG + Intronic
1101864208 12:108508096-108508118 ATAGATAAGAATTCCCAGGAGGG - Intergenic
1103362628 12:120362781-120362803 TAAGAGAAAAATACAGTGGAAGG + Intronic
1110263843 13:73516071-73516093 AAAGAGAAGAAAAGCCTGGAGGG - Intergenic
1111384775 13:87510770-87510792 ATAGAACAGACTACCCTGGATGG - Intergenic
1112097596 13:96151813-96151835 AGAGGGAAGACTACCATGGATGG - Intronic
1112156089 13:96818500-96818522 ATGGAGAAAAATATCGTGGGTGG + Intronic
1116056176 14:39866328-39866350 AAAAAGAAGAGTACCATGGATGG + Intergenic
1116176592 14:41478802-41478824 CTAAAGAAGAATAAGGTGGAAGG - Intergenic
1118116938 14:62789104-62789126 ATAGAGAATAAAACAGTGGTGGG - Intronic
1120238504 14:81921702-81921724 AAAGAGAAGAATAAAGTGGGAGG + Intergenic
1120898436 14:89555392-89555414 ATGGAGAAGACTACTGTTGAGGG - Intronic
1128584450 15:68835614-68835636 ATAGTGATTAATACAGTGGATGG - Intronic
1131320333 15:91383610-91383632 AGAGACAAGAATTCCGTTGAAGG - Intergenic
1132082552 15:98879448-98879470 ATGGAGAATAAAACAGTGGAAGG - Intronic
1133868737 16:9668517-9668539 ATTGAGAATAATACCCTGGCAGG + Intronic
1136617958 16:31410285-31410307 ACAGAGAAGAAAAGCCTGGATGG + Intronic
1139109491 16:63872218-63872240 AAAAAGAAGAATAATGTGGAGGG + Intergenic
1140864253 16:79046096-79046118 ATAGAAAAGAAAACTGTGGCCGG - Intronic
1143918540 17:10312829-10312851 AGAGAAATGAATAGCGTGGAAGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1150951361 17:69805429-69805451 ATAGAGATGAATGCCGTGAAGGG + Intergenic
1153628059 18:7040528-7040550 ACAGAGATGAAACCCGTGGAGGG + Intronic
1156128373 18:33936519-33936541 ATTGAAAAGAACACAGTGGAGGG - Intronic
1156766832 18:40666707-40666729 AGAGATAAGGATACCTTGGAAGG - Intergenic
1156803835 18:41152163-41152185 AGAGAGAAGAATATTTTGGAGGG - Intergenic
1157481746 18:48059768-48059790 ATAAAAAAAAATACTGTGGAGGG + Intronic
1157524140 18:48366054-48366076 TTAGAGAGGAATAAGGTGGAAGG - Intronic
1158446387 18:57526025-57526047 AGAGGGAAGAAGACGGTGGAAGG + Intergenic
1159864213 18:73685670-73685692 CTGGAGCAGAATCCCGTGGAGGG + Intergenic
1160241466 18:77127084-77127106 ATAAAGAATAATAAAGTGGAAGG + Intronic
1167353163 19:48988323-48988345 AAAAAGAAGCATCCCGTGGAAGG - Intronic
925798683 2:7574672-7574694 TTGGTGAAGAATACCTTGGAGGG + Intergenic
933025607 2:77253819-77253841 ACAGAAAAAAATACCCTGGAGGG + Intronic
935941639 2:108245081-108245103 ATGGAGAAGAAAACAGTAGAGGG + Intergenic
936811717 2:116410538-116410560 AAAGAGGAGAATACCATGGAAGG - Intergenic
937703899 2:124895796-124895818 ATAGAGAATAAGACAGTGGGAGG + Intronic
939155178 2:138516590-138516612 ATAGTGAAGAAAACTGTGGAGGG + Intronic
942179318 2:173364957-173364979 AGAAAGAGGAAGACCGTGGATGG + Exonic
944385510 2:199159618-199159640 ATAGAGTATAAGACTGTGGATGG - Intergenic
945318399 2:208394412-208394434 ATAGAGAAGAAAACAGTAGGGGG + Intronic
946021916 2:216646213-216646235 ATGGAGAAGAGGACAGTGGAAGG + Intronic
948646418 2:239407851-239407873 AGAGAGAAAGATACCCTGGAGGG + Intergenic
1169937801 20:10903615-10903637 ATAGTAAAGAATACTGTGGCGGG + Intergenic
1170276156 20:14592024-14592046 ATAGAGAGGACTGCAGTGGAAGG + Intronic
1170378885 20:15734246-15734268 AGAGAGAAGAACAGGGTGGAAGG + Intronic
1173271452 20:41539508-41539530 ATAGAGAAGTATCCAGTGAAAGG + Intronic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1176529004 21:7943684-7943706 ATGGAGAGGAATAAAGTGGAAGG - Intergenic
1182181695 22:28356295-28356317 ATAGAGGAGAATCCAGTGGATGG - Intronic
949731091 3:7113796-7113818 ATAGAAAACCATACCGTTGAGGG - Intronic
950971408 3:17192218-17192240 ATAGAGAAGAAAAAAGTGAAAGG + Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
956590496 3:70909127-70909149 AAAGAGAAGAAAATCTTGGATGG - Intergenic
957959208 3:87227535-87227557 TTCAAGAAGAAAACCGTGGATGG + Exonic
962178774 3:133183428-133183450 ATAGAGAAGATAAGCCTGGAGGG + Intronic
970108824 4:12615200-12615222 ATAGAGAAGAATACAGACCATGG - Intergenic
971116243 4:23648813-23648835 ATAGAGAAGAAAACAGTGGTGGG - Intergenic
972105325 4:35478547-35478569 ATACACAAGAATACTGTAGAAGG - Intergenic
972919942 4:43926098-43926120 ATACAGAATAATACATTGGAGGG - Intergenic
973783115 4:54308918-54308940 ATAGAGAAGAAAACTGTGGTAGG + Intergenic
978529389 4:109698930-109698952 GTAGAGAGGAATTCAGTGGAAGG - Intronic
980106627 4:128594480-128594502 AAAGAGAAGAACATCATGGAAGG - Intergenic
981363763 4:143877421-143877443 ATGCATAAGAATACTGTGGAAGG - Intronic
981374493 4:143998197-143998219 ATGCATAAGAATACTGTGGAAGG - Intronic
984708368 4:182864121-182864143 ATAGAGAAGACTGTTGTGGAAGG - Intergenic
985304202 4:188521367-188521389 ATAGAAAAGAAAACCCTGGTTGG + Intergenic
993942561 5:94077722-94077744 ATAGAGAATAAAGCGGTGGAAGG + Intronic
994995419 5:107056372-107056394 ATAGTGAAGAATAAACTGGAAGG + Intergenic
996434596 5:123420971-123420993 AGAGAGAAGAATAGTTTGGAGGG + Intronic
996694035 5:126373712-126373734 ATAGAGAAAACTACTTTGGATGG + Intronic
998710139 5:144814834-144814856 ATAGAGAAGATTACCCTAAAAGG + Intergenic
999001145 5:147924257-147924279 ATTGAGATGCTTACCGTGGAGGG - Intergenic
999349466 5:150855030-150855052 ATAGAAAAAAATACTATGGATGG - Intronic
999476812 5:151907808-151907830 ATGGAGAAGATGACCTTGGAAGG + Intronic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1001728832 5:173932207-173932229 ATAAAGAAAATTACCTTGGATGG + Intronic
1004417577 6:15438701-15438723 AGATAGAAGGATACTGTGGAGGG - Intronic
1004950586 6:20666555-20666577 ATAAAGAAGAATACCTAAGACGG - Intronic
1007973119 6:46072976-46072998 ATAAAGAAAAATCCCCTGGATGG + Intronic
1008894140 6:56532772-56532794 ATATAGAATAATACGGTAGAAGG + Intronic
1010494562 6:76517479-76517501 ATAGAGAATAATACTGAGGCAGG + Intergenic
1012763602 6:103334277-103334299 ATAGTGGAGAATATCGTGCATGG + Intergenic
1013911521 6:115281302-115281324 CTAGATCAGAATATCGTGGAAGG - Intergenic
1017650684 6:156578752-156578774 ATAGAAGAGAAGACTGTGGATGG - Intergenic
1018220574 6:161574122-161574144 ATATTTAAGAAGACCGTGGACGG + Intronic
1020148710 7:5665181-5665203 ATAGAGAGGAATCCCCTGCATGG - Intronic
1020207156 7:6127708-6127730 ATTGTGAAGAATAAAGTGGAAGG - Intronic
1021559160 7:21951939-21951961 AAAAAGAAGAATACTGTTGAGGG - Intergenic
1028833337 7:95348563-95348585 ATAAAGAAGAAACCAGTGGATGG + Intergenic
1029304898 7:99611868-99611890 ATAGAGATGAAGCCAGTGGAGGG - Intergenic
1030365828 7:108645054-108645076 TTAGAAAAGAATAAGGTGGAAGG - Intergenic
1031550495 7:123105841-123105863 ATAGGGAAGAATACTGAGTAGGG + Intergenic
1031798677 7:126213691-126213713 ATAGAGGACAAAACGGTGGAAGG - Intergenic
1032459126 7:132096276-132096298 ATTGAGAAGGATACCATGGAAGG + Intergenic
1036157357 8:6354986-6355008 AAACAGAAGAATCCCCTGGAAGG - Intergenic
1037256710 8:16963798-16963820 ATACAGAAGAATAGCATAGAGGG - Intergenic
1043632027 8:82347332-82347354 ATAAAGAAAAAGACCATGGAGGG - Intergenic
1059016726 9:110525619-110525641 ATAAAGAAGAATACAGTAGAAGG + Intronic
1061673879 9:132204424-132204446 AGAGGGAAGAAAACCATGGAGGG + Intronic
1203387948 Un_KI270438v1:71988-72010 ATGGAGAGGAATAGAGTGGAAGG + Intergenic
1186475375 X:9853156-9853178 ATCCAGAAGCATCCCGTGGAGGG + Intronic
1189214494 X:39311417-39311439 AGAGAGAAGAACACAGGGGACGG + Intergenic
1192581887 X:72290048-72290070 TTAGAGAAGAATAAAGTGGGAGG - Intronic
1196425937 X:115569706-115569728 AAAGAGAAAAACACCATGGAAGG - Intronic
1198003699 X:132469099-132469121 ATAGAGAAGAATACCGTGGATGG + Intronic
1198649017 X:138840482-138840504 GTAGAGAAGTATACAGTGGCAGG - Intronic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1201631767 Y:16077731-16077753 GTAGAGAAGATTACCGAGTATGG - Intergenic