ID: 1198005521

View in Genome Browser
Species Human (GRCh38)
Location X:132489487-132489509
Sequence CCCCGCCCGGCCTTTGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198005513_1198005521 -2 Left 1198005513 X:132489466-132489488 CCATAGCAACCCCGGTCCCAACC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1198005511_1198005521 13 Left 1198005511 X:132489451-132489473 CCGGGCTCGCAGCTACCATAGCA 0: 1
1: 0
2: 1
3: 7
4: 135
Right 1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1198005508_1198005521 18 Left 1198005508 X:132489446-132489468 CCCGCCCGGGCTCGCAGCTACCA 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1198005510_1198005521 14 Left 1198005510 X:132489450-132489472 CCCGGGCTCGCAGCTACCATAGC 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 117
1198005509_1198005521 17 Left 1198005509 X:132489447-132489469 CCGCCCGGGCTCGCAGCTACCAT 0: 1
1: 0
2: 0
3: 1
4: 71
Right 1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198005521 Original CRISPR CCCCGCCCGGCCTTTGCCAA AGG Intronic
900132321 1:1092342-1092364 CTCGGCCCGGCCTTTGCTCAGGG + Intronic
900353171 1:2246930-2246952 CCGTGCCCGGCCTGTGCCCATGG - Intronic
900733714 1:4281095-4281117 CTCCACCCAGCCTATGCCAATGG - Intergenic
900782418 1:4626736-4626758 CTCCGCCTCGCCTTTGCCAGCGG + Intergenic
902336702 1:15758544-15758566 CACCCCCTGGCCTGTGCCAAGGG + Intronic
903986731 1:27234431-27234453 CCCCGCACCGCCGTGGCCAATGG - Intergenic
905214196 1:36395486-36395508 CCACGCCCGGCCTGTGGCTACGG - Intronic
908331415 1:63074509-63074531 GCCCGCGCGGCCTCTGCCAAGGG + Intergenic
1062836562 10:639902-639924 CCCCGCCCGGCCTGTATCCAAGG + Intronic
1064177368 10:13086734-13086756 CCGCGCCCGGCCTCTGTAAAAGG + Intronic
1071540520 10:86478802-86478824 CCACGCCCGGCCTTTTCCTCTGG - Intronic
1073135275 10:101216814-101216836 ACCCGCCCTGCCGTTGCCATCGG + Intergenic
1075644115 10:124086461-124086483 CCCAGCCCTGCCTTTCCCCATGG + Intronic
1077048339 11:555763-555785 CCGCACCCGGCCTTTGCGCAGGG + Exonic
1084276152 11:68051954-68051976 CCCCGCCCTGGCTTTGACATGGG + Intergenic
1084426183 11:69085666-69085688 CCCAGCCTGGCCCCTGCCAATGG + Exonic
1087427552 11:98010136-98010158 CCACGCCTGGCCTTTAACAAGGG + Intergenic
1089496461 11:118910631-118910653 CTCCGCCCGGGCTCTGCCGAAGG - Exonic
1092563360 12:9639148-9639170 CCACGCCCGGCCTTCCCCAAGGG + Intergenic
1096367357 12:51040024-51040046 CCGCGCCCAGCCCTGGCCAAGGG - Intergenic
1097848824 12:64391482-64391504 CCTCGCCCAGCCTTTGAGAAAGG + Intergenic
1102908453 12:116694899-116694921 ACCCACTCGGCCCTTGCCAAGGG - Intergenic
1103363654 12:120368324-120368346 CCCCCCCCGTCCTTTGCCCCCGG + Intronic
1113943384 13:114029991-114030013 CCCCGCCCTGCCCTGGCCAATGG + Intronic
1119181094 14:72605757-72605779 CCATTCCCGGCTTTTGCCAAGGG - Intergenic
1119601233 14:75978688-75978710 CCCTGCCCGGGCTTTTCCCAAGG + Intronic
1129226972 15:74175765-74175787 CGCTTCCAGGCCTTTGCCAATGG + Exonic
1132850069 16:2020904-2020926 CCCCTCCCTCCCTTAGCCAAAGG + Intergenic
1133023947 16:2979734-2979756 CCCCGCCTGGCCTTAGCTCAGGG - Exonic
1133615009 16:7468236-7468258 ACCCGCCCGACCTTTACCATTGG + Intronic
1136278699 16:29194455-29194477 CCTCGCCAGGCCTCTGCCCACGG - Intergenic
1138607433 16:58098044-58098066 CCCCTCCAGGCCTTTGTCCATGG + Intergenic
1139328703 16:66171149-66171171 CCCCGCCCAGCCTCTGCTCAAGG - Intergenic
1139483592 16:67244358-67244380 CCCAGACCTGCCTTTGCCAGAGG - Intronic
1142083091 16:88160536-88160558 CCTCGCCAGGCCTCTGCCCACGG - Intergenic
1142113028 16:88342101-88342123 CCCTGCCCGGCCTCTCCCACCGG - Intergenic
1143434566 17:6914164-6914186 CCACGCCTGGCCCTGGCCAAGGG - Intronic
1143669170 17:8384392-8384414 CCGCGCCCGGCCCCTGCAAATGG + Intergenic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1148798282 17:50207979-50208001 GCCCGCCCAGCCTTTGCCTGTGG - Intergenic
1152632677 17:81417557-81417579 CCCCCCCCCGCCCTAGCCAAAGG + Intronic
1155054535 18:22171943-22171965 CCCAGCCCGCCCATGGCCAACGG + Exonic
1157279310 18:46335216-46335238 CCACGCCAGGCCTTTGCCCCGGG + Intronic
1157535090 18:48452094-48452116 CACCCCCAGGCCTGTGCCAACGG - Intergenic
1157589070 18:48825259-48825281 CCCCTCCCTGCCCTTTCCAAGGG + Intronic
1161237345 19:3204535-3204557 CCCCGCCTGCCCTCTGCTAATGG + Intronic
1163584410 19:18156130-18156152 CCCGGCCCGGCCCTCGCCCACGG + Exonic
1164596044 19:29531085-29531107 CCCACCCCTGCCTCTGCCAATGG - Intronic
1165946599 19:39446715-39446737 CCAAGCCCGGCCTCAGCCAATGG - Intronic
1167708974 19:51098689-51098711 CCCCGCCTGGCCATCGGCAAGGG - Exonic
1167781464 19:51601599-51601621 CCCCGCCTGGCCATCGGCAAGGG + Intergenic
1168337753 19:55605846-55605868 TCCCGCCGGGCCCTTGCCAAGGG + Intronic
927818900 2:26245013-26245035 CTCCGCCCGGGCTTTCCCAAAGG + Intronic
932495363 2:72143422-72143444 CCCCGCCCGCCCTTCCCCCACGG + Intronic
933315183 2:80706618-80706640 CACCCCCAGGCCTTTGCCCATGG + Intergenic
933999445 2:87695314-87695336 CCCTTCCCAGCCTTTGCCATGGG - Intergenic
934765414 2:96877683-96877705 CCACGCCCAGCCTTTGGCACTGG + Intronic
935743555 2:106172189-106172211 CCCAGCCAGGCCTTTGGGAAGGG - Intronic
936294409 2:111255577-111255599 CCCTTCCCAGCCTTTGCCATGGG + Intergenic
938499237 2:131821864-131821886 CCCAGCCAGGGCTTTGCCCAAGG - Intergenic
940258902 2:151760340-151760362 TCTCGCCCGTCCTTTGCCAGAGG - Intergenic
941029422 2:160493858-160493880 CCCCGCCCGCCCTTCCCCCACGG - Intergenic
943069632 2:183124977-183124999 TCTCTCCCGGGCTTTGCCAAAGG + Intronic
946444401 2:219725999-219726021 CCCCACCTGGCCTTTGGCAGGGG - Intergenic
948591011 2:239050193-239050215 CCCTGCCAGGCCTTTGCAGAGGG + Exonic
1169349802 20:4858968-4858990 CCCTGCACAGCCTGTGCCAAAGG - Intronic
1172457892 20:35092402-35092424 CCCCGCTCGGCCCCTGACAAGGG + Intronic
1172876087 20:38165188-38165210 CCCCGCCCGACCATGGCCGAGGG - Exonic
1173246273 20:41340030-41340052 CCCGGCCCGGGCCTTGCCCAAGG + Intergenic
1181056972 22:20264914-20264936 CCCCGCCCGGCCCTGGCACAGGG - Intronic
1181280118 22:21713875-21713897 CCCAGCCTGGCCTGTGACAAGGG + Intronic
950875255 3:16265356-16265378 CCCCACCCCGCCTTTCCCGAGGG - Exonic
954455867 3:50599551-50599573 CCCCGTCCAGCCTTGGCCAGGGG + Intergenic
954457506 3:50607819-50607841 CCCGGCCCTGCCTATGCCTAAGG - Exonic
954689957 3:52390524-52390546 CCACGCCTGGCCTCTGCCTATGG - Intronic
956994275 3:74806120-74806142 CCGCACCCGGCCATTGCCCAAGG + Intergenic
960024015 3:112988136-112988158 CCACCCCCGGCCTGTGCCCACGG - Intergenic
967977017 3:195041157-195041179 CCCGGCCAGGCCTTGGCCTAAGG + Intergenic
970807035 4:20049169-20049191 CCCCTCTTGGCCTTTCCCAACGG + Intergenic
974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG + Intergenic
975622360 4:76307321-76307343 CCCTTCCCGGCCTTTGGAAAGGG + Intronic
984878593 4:184390958-184390980 CACAGCCCGGCCCTGGCCAAGGG - Intronic
985896898 5:2754031-2754053 CCCCGCCGGACCTCTGCCAGGGG + Intronic
988476693 5:31592329-31592351 CTGCACCCGGCCTTGGCCAAAGG + Intergenic
990198411 5:53344172-53344194 CCCAGCCAGGCTTCTGCCAAAGG + Intergenic
992114032 5:73522516-73522538 CCGTGCCTGGCCTATGCCAAGGG - Intergenic
998508665 5:142693220-142693242 CCGCGACAGGGCTTTGCCAAAGG - Intronic
998553216 5:143097528-143097550 CCGCGCCCGGCCATTGCATAAGG - Intronic
999868397 5:155726904-155726926 CCCCGCCCACCCATTGCCTAGGG + Intergenic
1000324692 5:160163310-160163332 CTCAGCCCAGCCTTGGCCAAGGG + Intergenic
1002382167 5:178838905-178838927 CCCCACCCAGCCTTGGCCTATGG - Intergenic
1002595997 5:180323715-180323737 CCCCTCCCTGCCTTTGCCTGGGG - Intronic
1002648556 5:180674360-180674382 CCCCACCCAGCCTTGGCCTATGG + Intergenic
1003354538 6:5354801-5354823 CCGCGCCCGGCCTATGCTAGTGG + Intronic
1005098145 6:22141066-22141088 CCGCGCCCGGCCTTAGCTCAGGG + Intergenic
1005532575 6:26722541-26722563 CGCCGCCGGGCCTGTGCCCATGG + Intergenic
1005538220 6:26779124-26779146 CGCCGCCGGGCCTGTGCCCATGG - Intergenic
1007390489 6:41547258-41547280 CCCCGCCGGGCCTCTGGGAATGG + Intronic
1009006857 6:57798711-57798733 CGCCGCCGGGCCTGTGCCCATGG - Intergenic
1009009070 6:57821474-57821496 CGCCGCCGGGCCTGTGCCCATGG - Intergenic
1011361113 6:86526349-86526371 CCCCGCCAGACCTCTGCCCAAGG - Intergenic
1013583929 6:111561896-111561918 CCCTGCGCTGCCTTTGCCCAGGG - Intronic
1015936663 6:138411665-138411687 CCACGCCCGGCCTCTGAGAAGGG - Intronic
1019279814 7:193895-193917 CCCTGCCCGGCCTCTTCCATGGG - Intronic
1019411071 7:906989-907011 CCCAGCCCTGCCTCTGCCCATGG - Intronic
1021436622 7:20624862-20624884 CCGCCCTTGGCCTTTGCCAAAGG + Intronic
1023546796 7:41326036-41326058 CTGCGCCCGGCCTATGCCACTGG + Intergenic
1024566855 7:50688517-50688539 CCCTCCCCGGCCTTTGTCTATGG - Intronic
1029715653 7:102324073-102324095 CCCCCCCCGGGCTCTCCCAAGGG + Intergenic
1034680724 7:152925612-152925634 CCTGGCCCGGCCTTGGCGAAGGG - Intergenic
1035264877 7:157685108-157685130 TCCCGCCTGGCCTTGGCCGACGG + Intronic
1035731538 8:1856855-1856877 CCCCTGCCAGCCTTTCCCAAGGG - Intronic
1037788088 8:21914570-21914592 ACCTGCCCTGCCTTTGTCAAAGG - Intergenic
1039493565 8:37965273-37965295 CGCAGCCCAGGCTTTGCCAACGG - Exonic
1045111846 8:98944320-98944342 CCGCGCCCGGCGTCTGCTAATGG - Intergenic
1047278884 8:123427556-123427578 CCACGCCTGGCCTTTGTCAAAGG + Intronic
1048961174 8:139579632-139579654 ACCCTTCCAGCCTTTGCCAAGGG + Intergenic
1049749727 8:144277454-144277476 CCCCGCCTGGCCTCTGCGGACGG + Intronic
1056189720 9:84173007-84173029 CCCGGCCCGGCCTGTGCTGACGG + Intergenic
1058155698 9:101512261-101512283 CCCCGCCCTGCCCGTCCCAAAGG + Intronic
1060810372 9:126608656-126608678 CCCGGCACAGCCTTTGCCACTGG - Intergenic
1061872709 9:133529229-133529251 GCCAGCCCGGCCTCTGGCAAGGG + Intergenic
1061961864 9:133992664-133992686 CCCCGCCGGGCCTTTGTCTCGGG - Intergenic
1062120873 9:134833480-134833502 GCCTGCCCTGCCTGTGCCAAAGG - Intronic
1190598649 X:52068675-52068697 CCCCGCCCGGACCTAGCCAAAGG - Intronic
1190610175 X:52185398-52185420 CCCCGCCCGGACCTAGCCAAAGG + Intronic
1198005521 X:132489487-132489509 CCCCGCCCGGCCTTTGCCAAAGG + Intronic