ID: 1198006800

View in Genome Browser
Species Human (GRCh38)
Location X:132503238-132503260
Sequence CAGAATAAGCCAGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198006793_1198006800 13 Left 1198006793 X:132503202-132503224 CCAAAGTCCAGGCTGTTTTGGGT No data
Right 1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG No data
1198006795_1198006800 6 Left 1198006795 X:132503209-132503231 CCAGGCTGTTTTGGGTGGTTCTG No data
Right 1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG No data
1198006791_1198006800 14 Left 1198006791 X:132503201-132503223 CCCAAAGTCCAGGCTGTTTTGGG No data
Right 1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198006800 Original CRISPR CAGAATAAGCCAGAGGAGGA GGG Intergenic
No off target data available for this crispr