ID: 1198008592

View in Genome Browser
Species Human (GRCh38)
Location X:132525843-132525865
Sequence ATTAAATTGTCACCAAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198008592_1198008597 19 Left 1198008592 X:132525843-132525865 CCAGGATTTGGTGACAATTTAAT No data
Right 1198008597 X:132525885-132525907 CTTAACATAGTGCCTTTCTTGGG No data
1198008592_1198008596 18 Left 1198008592 X:132525843-132525865 CCAGGATTTGGTGACAATTTAAT No data
Right 1198008596 X:132525884-132525906 ACTTAACATAGTGCCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198008592 Original CRISPR ATTAAATTGTCACCAAATCC TGG (reversed) Intergenic
No off target data available for this crispr