ID: 1198010367

View in Genome Browser
Species Human (GRCh38)
Location X:132546375-132546397
Sequence TACTGTGAGCAGAAAGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198010367_1198010369 28 Left 1198010367 X:132546375-132546397 CCTCTATCTTTCTGCTCACAGTA No data
Right 1198010369 X:132546426-132546448 AACAGAGTGTTTAAACAGTCTGG No data
1198010367_1198010368 5 Left 1198010367 X:132546375-132546397 CCTCTATCTTTCTGCTCACAGTA No data
Right 1198010368 X:132546403-132546425 AGTCATTTGCTGAGAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198010367 Original CRISPR TACTGTGAGCAGAAAGATAG AGG (reversed) Intergenic
No off target data available for this crispr