ID: 1198012488

View in Genome Browser
Species Human (GRCh38)
Location X:132572474-132572496
Sequence CTGTGAATCAGGAGCAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198012484_1198012488 -9 Left 1198012484 X:132572460-132572482 CCAGGACTGAAGCCCTGTGAATC No data
Right 1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG No data
1198012483_1198012488 -8 Left 1198012483 X:132572459-132572481 CCCAGGACTGAAGCCCTGTGAAT No data
Right 1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG No data
1198012481_1198012488 27 Left 1198012481 X:132572424-132572446 CCTGAGATATGGAGATCTGATGA No data
Right 1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198012488 Original CRISPR CTGTGAATCAGGAGCAACCA AGG Intergenic
No off target data available for this crispr