ID: 1198016663

View in Genome Browser
Species Human (GRCh38)
Location X:132618502-132618524
Sequence TGATCTCCACACTTCGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198016663_1198016666 30 Left 1198016663 X:132618502-132618524 CCACCCACGAAGTGTGGAGATCA No data
Right 1198016666 X:132618555-132618577 GTAGAGACTGTGTATAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198016663 Original CRISPR TGATCTCCACACTTCGTGGG TGG (reversed) Intergenic
No off target data available for this crispr