ID: 1198019590

View in Genome Browser
Species Human (GRCh38)
Location X:132644918-132644940
Sequence ACAACTTGTAAGGGTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198019578_1198019590 25 Left 1198019578 X:132644870-132644892 CCCCAGGTTGGCATTTCCCCAGT 0: 1
1: 0
2: 4
3: 19
4: 167
Right 1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 149
1198019584_1198019590 7 Left 1198019584 X:132644888-132644910 CCAGTCAGGAGAGACTGCTGCAC 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 149
1198019580_1198019590 23 Left 1198019580 X:132644872-132644894 CCAGGTTGGCATTTCCCCAGTCA 0: 1
1: 0
2: 0
3: 15
4: 123
Right 1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 149
1198019579_1198019590 24 Left 1198019579 X:132644871-132644893 CCCAGGTTGGCATTTCCCCAGTC 0: 1
1: 0
2: 2
3: 12
4: 119
Right 1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 149
1198019583_1198019590 8 Left 1198019583 X:132644887-132644909 CCCAGTCAGGAGAGACTGCTGCA 0: 1
1: 0
2: 0
3: 25
4: 194
Right 1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 149
1198019582_1198019590 9 Left 1198019582 X:132644886-132644908 CCCCAGTCAGGAGAGACTGCTGC 0: 1
1: 1
2: 4
3: 24
4: 194
Right 1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198019590 Original CRISPR ACAACTTGTAAGGGTAAAGG AGG Intronic
903697730 1:25220725-25220747 ACAGCAAGTAAGGGTAAAAGAGG + Intergenic
905056701 1:35100913-35100935 GCTACTTGGGAGGGTAAAGGTGG - Intronic
905134532 1:35788247-35788269 GCAACATGTAAAGGTCAAGGAGG - Intergenic
907629691 1:56068102-56068124 ACATCTTGGAGGGGTAGAGGAGG - Intergenic
908534474 1:65065972-65065994 ACAACTTGCCGGGGGAAAGGGGG + Intergenic
909206531 1:72765623-72765645 ACAACTGAAAAGGATAAAGGTGG + Intergenic
909433031 1:75611937-75611959 ACATATTGTAATGGTAGAGGGGG - Intergenic
910394647 1:86779649-86779671 AACACTTGTCAGGGTAAAGGTGG + Intergenic
911992483 1:104718978-104719000 ACACTTTGTTAGGGTAAAGGAGG - Intergenic
1063169035 10:3489656-3489678 ACAATGTGTAATGGTAAACGAGG - Intergenic
1064906877 10:20356625-20356647 ACCACTTTTAAGGGCAAAGAAGG + Intergenic
1065256894 10:23879173-23879195 AGAATTTCTAAGGGTGAAGGTGG - Intronic
1065375352 10:25034817-25034839 ACAGCATTTAAGGGAAAAGGGGG - Intronic
1067882662 10:50060058-50060080 CCAACTGGAATGGGTAAAGGCGG - Intergenic
1068432283 10:56948964-56948986 ACAGCTTGCAAAAGTAAAGGAGG + Intergenic
1069448349 10:68494975-68494997 GAAATTTGTAAAGGTAAAGGAGG + Intronic
1070164644 10:73888480-73888502 GCAACTTGTCAGAATAAAGGAGG - Intergenic
1072561805 10:96583600-96583622 ACATCTGGTAGGGGTAGAGGTGG - Intronic
1072829708 10:98644844-98644866 ACAGCTTGTAAGGGTAAAACTGG - Intronic
1073165826 10:101450009-101450031 ACTACTTGAAAGGGTAAGGTAGG + Intronic
1074524203 10:114250344-114250366 AGAACTTGAAAGGGAAAAAGTGG - Intronic
1079046522 11:17108902-17108924 ACTACTGGTAAGGGTGAAGATGG + Intronic
1079451143 11:20600851-20600873 TAATTTTGTAAGGGTAAAGGGGG - Intronic
1079455811 11:20635368-20635390 ACATCATGTAAGGGTTAAGAGGG - Intronic
1080161306 11:29179894-29179916 ACAACTAATAAGGGCAAAGCTGG - Intergenic
1084948635 11:72652572-72652594 ACAACTTTAAAGGGGAAGGGAGG + Intronic
1085002558 11:73053985-73054007 ACAAATTTTAAGGGAAAAGGGGG + Intronic
1087781163 11:102302697-102302719 ACAAAATGCAAGAGTAAAGGAGG - Intergenic
1091013487 11:132028099-132028121 ACAACTTGCAAGGACAAATGGGG - Intronic
1093649867 12:21630483-21630505 GCAACTTGGGAGGGTAAAGTGGG + Intergenic
1095228913 12:39710912-39710934 ACAAGTTATTGGGGTAAAGGTGG + Intronic
1095374594 12:41511610-41511632 ACAACATGCATGGTTAAAGGTGG + Intronic
1097887726 12:64746623-64746645 AAACCTTGTAAGGATAAAGTGGG - Intronic
1099351239 12:81571502-81571524 ACAACTTGTAAGTGAAGAGCTGG - Intronic
1102618766 12:114177045-114177067 TCAAGTTGTCAGGCTAAAGGAGG - Intergenic
1104143990 12:126015109-126015131 ACATTTTGTAAGGATATAGGTGG - Intergenic
1106219865 13:27736768-27736790 ACAACTGGTGAGGGTGAAGTTGG - Intergenic
1111330118 13:86754920-86754942 ATAAGTTGTTAGGGTACAGGTGG - Intergenic
1111459413 13:88519973-88519995 ACGACTTAAAAGGGTGAAGGTGG + Intergenic
1113098978 13:106696498-106696520 ACAACCTGTAAAGGGAATGGTGG + Intergenic
1113370502 13:109720640-109720662 ACAAATCTTAAGGGTAAATGAGG - Intergenic
1114365914 14:22026909-22026931 CCTACTTCTAGGGGTAAAGGGGG + Intergenic
1114947876 14:27709417-27709439 ACAAATCATAAGTGTAAAGGTGG - Intergenic
1116017881 14:39428993-39429015 ACAACTAATAAGGATAAAGAAGG - Intronic
1116532430 14:45989047-45989069 ATAAATTATAAGGGTAAAGAAGG - Intergenic
1117247538 14:53900783-53900805 TCATCTTGTCAGGGTAGAGGAGG + Intergenic
1120523961 14:85556351-85556373 ACTACTTGTATGGGAAATGGAGG - Intronic
1126619118 15:50618849-50618871 CCAACTTGTAAGTGAAAACGTGG + Intronic
1129941899 15:79505082-79505104 CAAAATTGTAAGGGGAAAGGAGG - Intergenic
1133052788 16:3127118-3127140 ACTACTTCTACTGGTAAAGGAGG + Intergenic
1135298504 16:21303602-21303624 AACCCTTGTAAGGGAAAAGGAGG - Intergenic
1135345303 16:21684226-21684248 ACAGCTAGTAAGTGTCAAGGTGG + Intronic
1135686189 16:24500099-24500121 AGAGCTTGTAGGGGTAAAGCTGG + Intergenic
1137834899 16:51582781-51582803 ACAATTTGGGAGGCTAAAGGGGG - Intergenic
1138072608 16:54008075-54008097 ACAACTTGTAAAGGAGCAGGTGG - Intronic
1139234360 16:65318883-65318905 ATAAGTGCTAAGGGTAAAGGAGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1139847922 16:69933653-69933675 AGAGCTTCTAATGGTAAAGGGGG - Intronic
1139870590 16:70105578-70105600 TCAACTTGTAAGGGTCATGATGG - Intergenic
1140946274 16:79770875-79770897 ACAAGTTGCAAAGGGAAAGGGGG - Intergenic
1141230345 16:82161433-82161455 ACAACTTGCTACGGCAAAGGAGG + Intronic
1143928109 17:10391356-10391378 GCAATTTGTAAGGGTTGAGGGGG - Intronic
1144924142 17:18788668-18788690 ACAACTTGGAAGGCTGAAGCAGG + Intronic
1145397974 17:22510917-22510939 CGAGCTTCTAAGGGTAAAGGAGG + Intergenic
1148210538 17:45806006-45806028 ACATCATGTAAGCTTAAAGGGGG + Intronic
1151344718 17:73494569-73494591 TCAAAGTGTAAGGGGAAAGGCGG - Intronic
1153984215 18:10338597-10338619 GCTACTTGTAAGGGTTGAGGTGG - Intergenic
1154063457 18:11084838-11084860 ACAACTTGTTGAGGCAAAGGAGG - Intronic
1156559280 18:38103850-38103872 TCAACTGGAAAGGGTAAAGTAGG + Intergenic
1165933640 19:39376057-39376079 AGAACTTGTTAGGGTAGATGTGG - Intronic
1166481094 19:43175065-43175087 ACAAATTGGAAGGGTTCAGGAGG + Intronic
1166923750 19:46251152-46251174 ACAACTAGTAATGGTAAACCTGG + Intergenic
929249832 2:39740816-39740838 ACTACTTGGAAGGCTAAAGTAGG - Intronic
929410441 2:41693139-41693161 ACAGCTTGTAAGAGTAATGTGGG - Intergenic
929707885 2:44234688-44234710 ACAATTTGTAAGAGTATAAGTGG - Intronic
931548421 2:63414849-63414871 ATAACTTATTGGGGTAAAGGTGG - Intronic
940562407 2:155315758-155315780 ACAATTTATAAAGGAAAAGGAGG - Intergenic
941064710 2:160888947-160888969 ATAAGTAGTAAGGGTAAAGAAGG + Intergenic
941108593 2:161392179-161392201 ACTAATTGTAATAGTAAAGGGGG - Intronic
942370464 2:175278960-175278982 ACAACTTCTAAGAATAAAAGGGG + Intergenic
943699519 2:190974556-190974578 ACAACTTTAAAGGGGAGAGGAGG + Intronic
944289295 2:197986976-197986998 ACAACTCTAAAGGGTGAAGGAGG + Intronic
944364608 2:198902992-198903014 CCAACATGTAAGAGTAGAGGGGG - Intergenic
944907406 2:204276287-204276309 TCAGCTTGGAAGGGTAAAGCAGG - Intergenic
948049983 2:234972883-234972905 ACAATCTGCAAAGGTAAAGGTGG - Intronic
1169043531 20:2516844-2516866 AGAAAGTGTTAGGGTAAAGGTGG + Intronic
1169721919 20:8687358-8687380 ATAAGTTATAAGGGTATAGGTGG + Intronic
1177799322 21:25812462-25812484 AGAACTTGTAAAGGCCAAGGTGG + Intergenic
1181178706 22:21052730-21052752 ACAACATGGAAGGGAACAGGTGG - Intronic
1182236198 22:28878815-28878837 ACTACTTGTGAGGGTAAGGTGGG - Intergenic
1182241487 22:28919805-28919827 ACATCTCTTAAGAGTAAAGGGGG - Intronic
1182870714 22:33644843-33644865 ACAACTTATAAGGGTTATGAAGG + Intronic
1184353509 22:43961559-43961581 ACTACTTGGAAGGGTAAGGCAGG - Intronic
952800635 3:37287599-37287621 ACAGCTTGTAAGAGGTAAGGAGG + Intronic
955936807 3:64110014-64110036 ACCACTTGTAAAAGTGAAGGAGG + Intronic
956929249 3:74024031-74024053 ACAAGTTTCAAGGCTAAAGGTGG + Intergenic
959019365 3:101171355-101171377 ACAACTTGTAACCACAAAGGGGG + Intergenic
962629412 3:137260578-137260600 ACAACATGTCAGGTTTAAGGGGG + Intergenic
964860809 3:161198935-161198957 ACAAGTTTTAGGGGTAAATGTGG - Intronic
965531566 3:169775330-169775352 ACAGATTGTAGGGGAAAAGGTGG + Intronic
965693613 3:171383548-171383570 GCAACTTGTAATGGGAAAAGTGG - Intronic
966731546 3:183155591-183155613 ACAACTTGTAAGTATATATGGGG + Intronic
967398770 3:189037070-189037092 ACAACTTGTATGAGGAAAGGAGG - Intronic
970438915 4:16062910-16062932 GCAACTTTTAGGGGAAAAGGGGG - Intronic
971061146 4:22971423-22971445 ACAACTGGTAAGTGTAATGATGG + Intergenic
975438364 4:74380737-74380759 ACAACCTGTAAGGGTAGAGAAGG - Intronic
977754651 4:100653230-100653252 ACATTTTGTGAGGGCAAAGGGGG - Intronic
977936099 4:102806426-102806448 TCAACGAGTAAGGTTAAAGGTGG + Intronic
979386346 4:120069348-120069370 ACAGCTTATAAGGATAAAGGAGG + Intergenic
980498332 4:133613630-133613652 ACAACTTCTTTGTGTAAAGGTGG - Intergenic
980783027 4:137516445-137516467 ACAGCTTATAAATGTAAAGGTGG + Intergenic
982927839 4:161361925-161361947 ACAATTTGTCAGAGTACAGGTGG + Intergenic
988872405 5:35405700-35405722 GAAACTTTTAAGGGTAAAGAGGG - Intergenic
994468853 5:100176381-100176403 ACAACTAGGAAGGCTGAAGGGGG + Intergenic
996015037 5:118523970-118523992 ACTACTTGTAAGAACAAAGGTGG - Intergenic
996591576 5:125153874-125153896 ACAACTGGTTAGGGAGAAGGAGG + Intergenic
996674481 5:126158305-126158327 ACAAGATGCAAGAGTAAAGGAGG + Intergenic
999565031 5:152849758-152849780 AAAATTAGTAAGGATAAAGGAGG - Intergenic
1014255410 6:119156299-119156321 ACAACTTCTAAGAGGAGAGGCGG - Intergenic
1014486425 6:122004479-122004501 ACAACAGGTAAGGGAAAGGGTGG - Intergenic
1015305208 6:131699459-131699481 ACAACTTTTAAGTGTGTAGGTGG + Intronic
1017047703 6:150362950-150362972 ACCGCTTGTAAGGGTACAGTTGG - Intergenic
1018171578 6:161147339-161147361 ACAAATAGGAAGGGCAAAGGTGG - Intronic
1018447779 6:163874131-163874153 ATAACTACTAAGAGTAAAGGAGG - Intergenic
1020161766 7:5778683-5778705 AAAACTTGTAAGGGTCAGCGTGG - Intronic
1020392241 7:7670730-7670752 CCAGGGTGTAAGGGTAAAGGAGG - Intronic
1020602644 7:10295147-10295169 ACAACATGAAAGGGTGAATGAGG - Intergenic
1021742176 7:23697861-23697883 CCTACTTGGAAGGGTAAAGCAGG - Intronic
1022548266 7:31209511-31209533 ATATCTTGCAAGGATAAAGGGGG - Intergenic
1023507583 7:40916470-40916492 ACATCTTGTGAGGATGAAGGAGG + Intergenic
1025959845 7:66210274-66210296 ACAAATTTTGAGGGAAAAGGAGG + Intronic
1027830630 7:83172683-83172705 ATATCTTGGAAGGGAAAAGGAGG - Intergenic
1028352773 7:89869442-89869464 CCAACTTTTAAAGGTAAAGGTGG + Intergenic
1030564031 7:111129003-111129025 ACATCTTGTAAGGGTTAATGTGG - Intronic
1031152761 7:118073750-118073772 ACAAGTTGTAGGGGATAAGGAGG - Intergenic
1033739319 7:144257686-144257708 ACAACTTTTAAGTGTGTAGGTGG + Intergenic
1035626094 8:1071680-1071702 ACAACTTGTTAGGATAACAGTGG + Intergenic
1037396713 8:18451200-18451222 ACTACGTGTAATGGTAGAGGGGG + Intergenic
1038053354 8:23834074-23834096 TCATCTTGTAGGGGTGAAGGTGG + Intergenic
1039377972 8:37056289-37056311 ACAACTGGTCAGGGTAATGGGGG + Intergenic
1041122230 8:54598844-54598866 ATTACCTGTAAGGGAAAAGGGGG - Intergenic
1041897979 8:62948085-62948107 ACAACTAGTAAGTGTAGAGCTGG + Intronic
1044481362 8:92692791-92692813 ACCACTTGTAAGGATGAATGGGG + Intergenic
1047820242 8:128511330-128511352 ACAAATGGTAAGGGAAAAGGAGG + Intergenic
1048034214 8:130661865-130661887 ATAAGTTGTAAGGGTTGAGGTGG - Intergenic
1048034220 8:130661891-130661913 ATAAGTTGTAAGGGTTGAGGTGG - Intergenic
1050921466 9:11206625-11206647 ACTACCTGTAATGCTAAAGGTGG - Intergenic
1051321449 9:15909660-15909682 ACAAATTTTAAGGATATAGGAGG - Intronic
1052090462 9:24320807-24320829 ACAAAATGTAAGAGTGAAGGAGG - Intergenic
1056850314 9:90078318-90078340 AGAACTTGTTAGGGTAATTGTGG - Intergenic
1060192803 9:121603787-121603809 CCAACTTGTAAATGTCAAGGTGG - Intronic
1061845925 9:133388178-133388200 ACAACTTGTGAGAGTAAACATGG - Intronic
1192692497 X:73379098-73379120 ACAACTTACAAGGGAAATGGAGG + Intergenic
1194471695 X:94304871-94304893 ACAAAATGCAAGAGTAAAGGAGG - Intergenic
1194733510 X:97484275-97484297 ACAACTAGTAATGGTAAAAACGG - Intronic
1195320938 X:103721544-103721566 ACAAATTGTCAGGGAAAATGTGG + Intronic
1195672192 X:107479173-107479195 ATCACTTGTAAGGATATAGGAGG + Intergenic
1196354400 X:114773180-114773202 ACAAGTTATAATGGGAAAGGGGG - Intronic
1198019590 X:132644918-132644940 ACAACTTGTAAGGGTAAAGGAGG + Intronic
1198146449 X:133862315-133862337 GCACCTTATAAAGGTAAAGGTGG - Intronic
1201508723 Y:14734055-14734077 ACAAATTGAAATGGTAAATGTGG + Intronic