ID: 1198020664

View in Genome Browser
Species Human (GRCh38)
Location X:132654448-132654470
Sequence AACCTCATGATGTTACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198020664_1198020667 6 Left 1198020664 X:132654448-132654470 CCTCTCTGTAACATCATGAGGTT 0: 1
1: 0
2: 2
3: 12
4: 145
Right 1198020667 X:132654477-132654499 AATGCAATGTGTACTATAGTTGG 0: 1
1: 0
2: 1
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198020664 Original CRISPR AACCTCATGATGTTACAGAG AGG (reversed) Intronic
905731512 1:40302178-40302200 AACCTCATCATGTGGCAGTGAGG - Intronic
905816589 1:40955624-40955646 ACCCTGGTGATGTTGCAGAGAGG + Intergenic
907507238 1:54928550-54928572 AACCTCATGAGGTTGCAGTGAGG + Intergenic
907813711 1:57897785-57897807 AACCACTTCATGTTACAGATGGG + Intronic
908630693 1:66103269-66103291 AACTTCCTGAAGATACAGAGAGG - Intronic
908789769 1:67770094-67770116 CACCTCAAGATGTAACAGATGGG + Intronic
909519574 1:76551875-76551897 GACCTCATGGAGGTACAGAGTGG - Intronic
910533231 1:88265680-88265702 GAACTCATGAAGATACAGAGTGG + Intergenic
912793781 1:112677346-112677368 AACATGATGAGGGTACAGAGCGG - Intronic
916483960 1:165241206-165241228 CACCTCATGGTGGTACAGATAGG - Intronic
918715375 1:187779742-187779764 AAACTCATGATTTTAAAGAATGG + Intergenic
918796833 1:188909927-188909949 AATATAATGATGTTTCAGAGGGG - Intergenic
919786445 1:201261295-201261317 AACCTCCTCATTTTACAGATTGG - Intergenic
924879175 1:248139643-248139665 CACCTCATCATGTGAGAGAGAGG + Intergenic
924884356 1:248196945-248196967 CACCTCATCATGTGAGAGAGAGG + Intergenic
924892874 1:248303694-248303716 CACCTCATCATGTGAGAGAGAGG - Intergenic
924895149 1:248330113-248330135 TACCTCATCATGTGAGAGAGAGG - Intergenic
1063290350 10:4739455-4739477 AATATCATGATGACACAGAGTGG - Intergenic
1065435845 10:25703125-25703147 TCCCTCATGAGGTTACAGTGAGG - Intergenic
1067259802 10:44679515-44679537 AGCCCTTTGATGTTACAGAGTGG - Intergenic
1068242848 10:54326702-54326724 ACCCTCATGATGTTCAAGAGAGG - Intronic
1070199456 10:74189449-74189471 AACCTCAAAATATTGCAGAGCGG - Intronic
1071434142 10:85631259-85631281 AAACTTTTGATGTGACAGAGAGG - Intronic
1073312651 10:102554857-102554879 AACCGCATGAAGTTATCGAGAGG + Intronic
1077121192 11:909409-909431 CACCTTATCTTGTTACAGAGCGG - Intronic
1078771355 11:14355332-14355354 GACTTCAGGATGGTACAGAGTGG - Intronic
1083732945 11:64662899-64662921 AACTTCATGGGGTTAAAGAGAGG + Intronic
1084796483 11:71508947-71508969 AACTTCATTATGTTGAAGAGTGG - Intronic
1085838836 11:79986714-79986736 CACCCCATGAAGTTAGAGAGAGG + Intergenic
1089342169 11:117765388-117765410 ACCCTCATGGTGGGACAGAGAGG - Intronic
1090200415 11:124850830-124850852 GATCTCATGAAGATACAGAGTGG + Intergenic
1093001239 12:13998858-13998880 CACCTCATGAAGGGACAGAGGGG - Intergenic
1093678652 12:21974427-21974449 AACCCCATGTTGTTAGAGAAGGG + Intergenic
1095170338 12:39027468-39027490 AACCTGATGATGTCAAAAAGTGG + Intergenic
1095838276 12:46662934-46662956 AACCTCCTCATTTTACAGACTGG + Intergenic
1098482423 12:70980870-70980892 AAACTCATAATGTTACAGTCAGG + Intergenic
1099457342 12:82879748-82879770 AACATCATGATGTTTTAGAAAGG + Intronic
1099727889 12:86457865-86457887 AAGCACATGAAGTTAGAGAGAGG - Intronic
1101496803 12:105262413-105262435 TACCTCATGAGGTTACTGAGAGG + Intronic
1101589680 12:106114573-106114595 AATCTCCTCATGTTACAGATGGG + Intronic
1106411302 13:29513419-29513441 AATTTCATCATGTCACAGAGAGG + Exonic
1113069629 13:106407840-106407862 AACATCGTGATGTTATGGAGAGG - Intergenic
1114429659 14:22649838-22649860 AACCTCCTCATGTCACAGAAGGG + Intergenic
1116603508 14:46959469-46959491 AAGCTCATGATGTTTAAAAGAGG - Intronic
1117789499 14:59324548-59324570 AAGCTCTTTATGTTACAGACAGG - Intronic
1118052075 14:62040250-62040272 AACCTCATGAAGATATGGAGAGG + Intronic
1119750344 14:77072865-77072887 AGGCTTATGATGTTTCAGAGGGG + Intergenic
1123807572 15:23890136-23890158 AACCCCATGATTTTACAGTGAGG + Intergenic
1124140387 15:27072269-27072291 TACCTCACAATGTTACCGAGTGG - Intronic
1125784872 15:42307309-42307331 AAGATGATGATGTTACAGAAAGG - Intronic
1125888031 15:43243502-43243524 AACAGAATGAAGTTACAGAGGGG + Intronic
1128522616 15:68385837-68385859 AGCCTCATGATTTTACAGATGGG - Intronic
1130612105 15:85370884-85370906 AAAATCATTCTGTTACAGAGAGG + Intergenic
1134307833 16:13049319-13049341 AACCTGATTATTTTACAGATGGG - Intronic
1135690983 16:24537650-24537672 ACCCTCAGGATATGACAGAGTGG - Intergenic
1137395506 16:48114016-48114038 ACCCTCATGAGGTGACAGAATGG - Intronic
1137670745 16:50277021-50277043 AAACTCTTGATTTCACAGAGTGG - Intronic
1139248452 16:65471505-65471527 GACCTCATGATGTTATGGTGAGG - Intergenic
1141223436 16:82092564-82092586 AACCTCCTAAGGTTGCAGAGGGG + Intronic
1144699018 17:17324665-17324687 TCCCTCATGATTTTAGAGAGTGG + Intronic
1147458257 17:40552160-40552182 ATCCTAATGAGGTTACAGATGGG - Intergenic
1150577395 17:66442350-66442372 AACATCATGATGTTACAGGCAGG - Intronic
1155179417 18:23331118-23331140 AACCTCATGGTCTGAGAGAGTGG + Intronic
1155425545 18:25702857-25702879 AACCTCATAGTGTTACAGTGAGG + Intergenic
1157103654 18:44753099-44753121 GACCTCTTGATCTTTCAGAGAGG - Intronic
1160160771 18:76468351-76468373 AACCTCATAATGTTTAAGAAAGG - Intronic
1161571450 19:5032921-5032943 AACGTCATGATTTTACAGCTGGG - Exonic
926363270 2:12110102-12110124 TTCCTCATGAATTTACAGAGAGG + Intergenic
926600130 2:14833451-14833473 TACCTCATGCTGTTATAGTGAGG + Intergenic
928742611 2:34372821-34372843 AAGCTCATGATATGACAGAGAGG + Intergenic
929082950 2:38139126-38139148 AACTTCATGGTGTTAGAGACAGG + Intergenic
929463663 2:42125541-42125563 AAACTAATGATGATACAGAAGGG + Intergenic
935322320 2:101901231-101901253 AACCTCAGCATGTAACACAGTGG - Intergenic
938420224 2:131139821-131139843 AACCTTATCATTTTACAGATGGG + Intronic
939389583 2:141549252-141549274 AACCTCATGACGTTATCGTGAGG + Intronic
944951435 2:204754346-204754368 AAGCTCATAATGTTAAAGAGAGG + Intronic
946318469 2:218932987-218933009 ACCTTCATGAGGTTACAAAGGGG - Intergenic
948280509 2:236743703-236743725 TAGCTCATGAACTTACAGAGTGG + Intergenic
1172828069 20:37807190-37807212 AGCCTCATTATTTTACAGATAGG - Intronic
1173033487 20:39384909-39384931 AACCTCAAAATGTTCCAAAGAGG - Intergenic
1176259226 20:64170543-64170565 AACCTCAAGAAGGAACAGAGTGG - Intronic
1180572350 22:16738396-16738418 AATCTCATGATGTTTCAGAGAGG - Intergenic
1182387094 22:29953514-29953536 TACCTCATTATTTTACAGAAAGG + Intronic
1183110067 22:35642369-35642391 GACCTCATGATGCTCCAGAAGGG - Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
951697404 3:25460109-25460131 AAACTAATGATGACACAGAGTGG - Intronic
953574026 3:44098381-44098403 AACCTTATGATGTTGCAGACTGG - Intergenic
954554207 3:51505574-51505596 AGTCTCATGATGTTCCTGAGGGG + Intergenic
955857881 3:63293685-63293707 AACTTCCAGAAGTTACAGAGAGG - Intronic
956975182 3:74570620-74570642 AAACTGATTATGTTACAGTGTGG + Intergenic
957253336 3:77803864-77803886 ACTATCATCATGTTACAGAGAGG + Intergenic
958708175 3:97683535-97683557 AACCTTACAATTTTACAGAGAGG + Intronic
962086006 3:132192121-132192143 AGCCTAATGAAGTTACAGACTGG + Intronic
963975686 3:151477742-151477764 AAGTTCATGATGTTAGAGAAGGG + Intergenic
969100828 4:4766896-4766918 AACCGGGTCATGTTACAGAGGGG + Intergenic
970657294 4:18245671-18245693 AACCTCATGAGGTTACCATGAGG + Intergenic
971179280 4:24313292-24313314 AACCTTATTATGTGAAAGAGAGG + Intergenic
972361083 4:38325970-38325992 CACCTCATGATATTACAGGAAGG + Intergenic
972476069 4:39450836-39450858 AAGCCCTTGATGTTAAAGAGAGG - Exonic
974010652 4:56604119-56604141 AACGTCTTTGTGTTACAGAGGGG + Intergenic
975273794 4:72470306-72470328 ATCCTCATGGTATTCCAGAGAGG - Intronic
977313442 4:95414732-95414754 ATCCACATGATGTTAATGAGAGG + Intronic
979485061 4:121261860-121261882 AACCTCTTTATTTTACAGATGGG + Intergenic
981040993 4:140221221-140221243 AAGCTCTTGATGTGGCAGAGAGG - Intergenic
981398742 4:144286695-144286717 AATTCCATGATGTGACAGAGAGG - Intergenic
981836962 4:149065334-149065356 GAGCTCATGATGTTAAAGTGTGG + Intergenic
983116726 4:163827203-163827225 AACATCAATATGTTTCAGAGAGG - Intronic
985970831 5:3377271-3377293 ACCCTCCTGGTTTTACAGAGGGG - Intergenic
987765258 5:22219277-22219299 AAGATCATATTGTTACAGAGTGG + Intronic
987997336 5:25301519-25301541 AAAATGATGAAGTTACAGAGAGG - Intergenic
988441332 5:31237097-31237119 AACCTCACCGTGTTTCAGAGAGG + Intronic
989044799 5:37264300-37264322 AATCTCATGGTGATAAAGAGTGG - Intergenic
991562965 5:67973763-67973785 AACCTGATGATTTTATATAGTGG - Intergenic
991727152 5:69546837-69546859 AACATCTTCATTTTACAGAGGGG - Intronic
991867805 5:71081037-71081059 AACATCTTCATTTTACAGAGGGG + Intergenic
992397450 5:76380952-76380974 CATCTCATGATGTTTGAGAGAGG - Intergenic
994276203 5:97841284-97841306 AACATGAGGAAGTTACAGAGTGG - Intergenic
999207766 5:149862404-149862426 AAGCTCATGATGGTATAGATAGG + Intronic
999708558 5:154295793-154295815 AACCTCAGGATGTTATTGTGAGG + Intronic
1003761522 6:9183853-9183875 AACCATAAAATGTTACAGAGCGG + Intergenic
1004615544 6:17284789-17284811 AAGATCATGATGTCACAGAATGG + Intronic
1007123659 6:39405454-39405476 AACCTCATGATCGTATAAAGTGG - Intronic
1008750408 6:54727131-54727153 AACCTCATAATTTTACTAAGAGG + Intergenic
1011947429 6:92923675-92923697 AAACTCATGATGATGGAGAGTGG - Intergenic
1011991854 6:93530722-93530744 AACATCATTATTTTACTGAGAGG + Intergenic
1015343401 6:132128155-132128177 ACCCTCATGATTTTACAGAGAGG - Intergenic
1016757601 6:147703752-147703774 AACCTCATCATGATAAAGACAGG - Intronic
1017219215 6:151946570-151946592 AACATGATGAAGTTACAGAGTGG - Intronic
1017621647 6:156305312-156305334 AACCTGCTGATGTAACACAGAGG - Intergenic
1018921999 6:168181778-168181800 AGCCTGATGGTGTTAGAGAGTGG - Intergenic
1023614238 7:42002887-42002909 CACCTCATTAGGTTACTGAGTGG + Intronic
1024160808 7:46673352-46673374 AACATCATCAAGTTAAAGAGAGG - Intergenic
1024278884 7:47701715-47701737 AATCTTATGATGATACATAGTGG + Intronic
1024495013 7:50035818-50035840 ACCCTCAAAATGTTAAAGAGAGG + Intronic
1028388561 7:90288285-90288307 GACCCCAGGAAGTTACAGAGTGG + Exonic
1035046121 7:155967621-155967643 AACCTCATGAAGATAGAGACTGG - Intergenic
1036179664 8:6573353-6573375 AGGCTCATGATGTTAAAGAGGGG + Intronic
1037513559 8:19607774-19607796 AACCTCTTCATTTTACAGATTGG - Intronic
1037969677 8:23163452-23163474 AACCTCAGGAAGCCACAGAGCGG - Intronic
1044714677 8:95089544-95089566 AACCTCAGAGTTTTACAGAGTGG + Intronic
1048862863 8:138736819-138736841 AACCCCATCATTTTACAGATGGG + Intronic
1050686687 9:8178450-8178472 AATCTCATGGTTTTACAAAGAGG + Intergenic
1051087001 9:13361493-13361515 AATCTCATGACCTTACAGATAGG - Intergenic
1058488434 9:105467080-105467102 AAGGTCATGCTGTTACTGAGTGG + Intronic
1061744239 9:132728023-132728045 AACCAGGTGATGATACAGAGAGG - Intronic
1062076258 9:134591573-134591595 AACCAGGTGATGATACAGAGAGG - Intergenic
1185451877 X:286045-286067 AACCTCAGGATGTCACACTGGGG - Intronic
1187012404 X:15293463-15293485 AACCTCATGAAGTTATTGGGTGG + Intronic
1189268179 X:39731992-39732014 AACCCCATCATGATACAGTGTGG - Intergenic
1190241658 X:48661196-48661218 GAACTCATCATGTCACAGAGAGG - Intergenic
1191897505 X:66008805-66008827 TACCTCATGGGGTTACAAAGTGG - Intergenic
1192043475 X:67647066-67647088 TACCTCATTATGTTTCAAAGAGG + Intronic
1193820811 X:86162278-86162300 AGCCTCTTGATTTTACAGACAGG + Intronic
1195452956 X:105036034-105036056 TACCTCATGATCTTCCATAGAGG - Intronic
1195463926 X:105158841-105158863 AACCCCTTCATGTTCCAGAGAGG - Intronic
1197951527 X:131902747-131902769 AACTTCATGAGGTTATAGAAAGG - Intergenic
1198020664 X:132654448-132654470 AACCTCATGATGTTACAGAGAGG - Intronic
1198274600 X:135089118-135089140 AGCCTGATGATGTGACAGAAAGG + Intergenic
1198330395 X:135617409-135617431 AACCTCGTGAGCTCACAGAGTGG - Intergenic
1198336532 X:135671590-135671612 AACCTCGTGAGCTCACAGAGTGG + Intergenic