ID: 1198028857

View in Genome Browser
Species Human (GRCh38)
Location X:132735655-132735677
Sequence CTGGATGCCCACATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198028854_1198028857 -8 Left 1198028854 X:132735640-132735662 CCAGTTCTGCTTTCTCTGGATGC 0: 1
1: 1
2: 1
3: 24
4: 288
Right 1198028857 X:132735655-132735677 CTGGATGCCCACATGGAGCTGGG 0: 1
1: 0
2: 1
3: 20
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198028857 Original CRISPR CTGGATGCCCACATGGAGCT GGG Intronic
902169294 1:14598080-14598102 CTGGATGCACACACAGGGCTAGG + Intergenic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
903274684 1:22212971-22212993 CTGGAATCCCACCTGGAACTCGG - Intergenic
903385618 1:22924349-22924371 GTGGATGCCCATTTGGAGCCTGG - Intergenic
904258043 1:29269449-29269471 CTGAATGCCCACTTTGTGCTGGG + Intronic
911064264 1:93773652-93773674 CTGGATTTCCACATGGTGCTGGG + Intronic
912822772 1:112881070-112881092 CTGGATGCCCAAGGGGAGCCGGG + Intergenic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
915942919 1:160130246-160130268 CAAAATGCCTACATGGAGCTGGG + Exonic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
917444430 1:175095170-175095192 ATTGAGGCCCACATGGATCTAGG - Intronic
918187849 1:182143748-182143770 CTGGGTGCCCCCATTAAGCTAGG - Intergenic
921237234 1:213145558-213145580 CTGGTTGCTCACACAGAGCTGGG + Intronic
921521623 1:216162772-216162794 AAGGATGCACACATGGAGTTTGG - Intronic
922419292 1:225448714-225448736 CTGGATGTCCTCATGGTGCCTGG + Intergenic
924185519 1:241485169-241485191 CTGGATGCCCAAATGGTGGGAGG + Intergenic
924827473 1:247555947-247555969 ATGGATGCCCACATGCAGCAGGG + Intronic
1065612212 10:27483109-27483131 CTGGCTGCTCTCATGGAGCCAGG + Intergenic
1067062506 10:43085086-43085108 CTGGAGGCCAGCATGGAGCTGGG + Intronic
1067182169 10:43996519-43996541 CTGGATGTCACCGTGGAGCTGGG - Intergenic
1067260427 10:44685078-44685100 CAGCATGCCCACATGGAACCAGG + Intergenic
1069738218 10:70671478-70671500 CTGGATGCTCTGATGTAGCTTGG + Intergenic
1071489913 10:86129212-86129234 CTGAATGCTCATATGGAGATGGG - Intronic
1071490762 10:86134962-86134984 CTACATGCCCACATAGAACTTGG + Intronic
1073320111 10:102610825-102610847 CTGGCTGATTACATGGAGCTAGG - Intronic
1074470955 10:113726318-113726340 CTGGATGCCATCATCAAGCTCGG - Exonic
1075714038 10:124545605-124545627 TTTCATGCCCACGTGGAGCTCGG - Intronic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1076250850 10:128982774-128982796 CTGGATGCCCAGGTTGAGCCAGG + Intergenic
1077468924 11:2747749-2747771 CTGGTTGCCCACAGGGAGTGGGG + Intronic
1077591262 11:3492630-3492652 CTGGATGGGGGCATGGAGCTAGG + Intergenic
1082658829 11:55885135-55885157 CTGGATGTCGACATGAAACTCGG - Intronic
1082766714 11:57174593-57174615 CTGCATTCTCACCTGGAGCTTGG + Intergenic
1084246963 11:67864381-67864403 CTGGATGGGGGCATGGAGCTAGG + Intergenic
1084554543 11:69868130-69868152 CTGGGTGCCCACAAGGGCCTGGG - Intergenic
1084825726 11:71730150-71730172 CTGGATGGGGGCATGGAGCTAGG - Intergenic
1085155209 11:74287057-74287079 CTGGATTCCCACAGGGCCCTTGG + Intronic
1085620800 11:78036758-78036780 CTGGCTGCCCTCATGGAGCTTGG - Intronic
1086943347 11:92820631-92820653 CTGGAAGCTCAAATGGAGGTTGG - Intronic
1088207323 11:107408100-107408122 CTGGATGCCCAGATTGCACTAGG + Intronic
1088686477 11:112288457-112288479 CTGGAGGCCAAGAAGGAGCTGGG + Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1088878130 11:113952554-113952576 CTGGCTGTCCACATGCAGCCCGG - Intergenic
1089785287 11:120903205-120903227 CTGGATGCAGACAGGCAGCTGGG - Intronic
1090471442 11:126984759-126984781 CTGCGGGCTCACATGGAGCTTGG - Intronic
1091030897 11:132186859-132186881 CCGGATCCCCACAGGGGGCTCGG - Intronic
1091368310 11:135039628-135039650 CAGGAAGCCCAAGTGGAGCTGGG + Intergenic
1093779609 12:23120484-23120506 CTGAATTCCCACAAGGAGCTGGG - Intergenic
1098051236 12:66455516-66455538 CTGTATGCACTCATGGAGGTAGG + Exonic
1098184144 12:67878581-67878603 AGGGATGCTCATATGGAGCTTGG + Intergenic
1098670735 12:73227255-73227277 CTGGATTCACACATGCTGCTAGG + Intergenic
1101398533 12:104368814-104368836 CTGGAAGCCCAGGTGGGGCTTGG - Intergenic
1104680525 12:130748147-130748169 CTGGAGGCCTGCATGGAGCAGGG - Intergenic
1105468663 13:20671825-20671847 CTGGATAGTTACATGGAGCTAGG - Intronic
1105762034 13:23524228-23524250 CTGGTTAACCACATGGACCTGGG - Intergenic
1107126427 13:36851348-36851370 CTGGAAGGAGACATGGAGCTAGG - Intronic
1108521688 13:51252002-51252024 CTGGATGTCCACATCCAGGTTGG - Exonic
1108594057 13:51935450-51935472 GTGGCAGCCCACATGGAGCCTGG - Intronic
1109263996 13:60175625-60175647 CTGGATCCCCACATGGTGGAGGG - Intergenic
1109927766 13:69168360-69168382 CTGGATGCCCAACAAGAGCTCGG + Intergenic
1113766957 13:112887812-112887834 CCGGGTGCCCCAATGGAGCTGGG - Intergenic
1113867797 13:113539369-113539391 CTGGACGTCTCCATGGAGCTGGG + Exonic
1114075682 14:19159966-19159988 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1114086479 14:19239606-19239628 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1114469187 14:22947489-22947511 CTGGATACCCACAAGGCGCTAGG + Intronic
1114576528 14:23719400-23719422 CAGGATGCCAGAATGGAGCTGGG + Intergenic
1116892647 14:50283446-50283468 TGGGAGGGCCACATGGAGCTAGG - Intronic
1117882694 14:60327889-60327911 CTGGATGGCCACGCGGCGCTGGG + Intergenic
1117969150 14:61235176-61235198 AGGGATGCCCATATGGAGCATGG - Intronic
1117979667 14:61329977-61329999 CTGGATGCTCACCTAGGGCTTGG - Intronic
1118781871 14:69013984-69014006 CTGCCTGCCCCCAAGGAGCTCGG - Intergenic
1121275954 14:92667787-92667809 CTGAATGACCATATGGAGCATGG - Intronic
1121778563 14:96607078-96607100 CTGGATGCCCACAGAGGGTTGGG - Intergenic
1122268562 14:100558027-100558049 CTGGAGCCCCACCTGCAGCTGGG - Intronic
1122928777 14:104923798-104923820 CTGGATGCCTGAATGCAGCTGGG - Intergenic
1122947334 14:105018616-105018638 CAGGAGGCCCTCAGGGAGCTGGG - Intronic
1202831868 14_GL000009v2_random:43189-43211 CTGGAGGCCCACATGCAGTGGGG - Intergenic
1123825566 15:24078602-24078624 CAGCCTGCCCACATCGAGCTCGG - Intergenic
1126272079 15:46831728-46831750 CCTGATGCCCACATAGAGCCAGG + Intergenic
1126807664 15:52368314-52368336 CTGAAAGCCCACAGAGAGCTGGG - Intronic
1127391654 15:58510108-58510130 CTGAATGCCAACATGGTGCTAGG + Intronic
1128269047 15:66293250-66293272 CTCCATTCCCACATGGACCTGGG + Intronic
1128646034 15:69379638-69379660 CTGGATTCCCAAAGGGAGCCTGG + Intronic
1128683560 15:69668000-69668022 CTGCATGTCAACATGGAGCCAGG - Intergenic
1128801157 15:70497987-70498009 CTTGCTGCCCACAGGGAACTAGG + Intergenic
1128945007 15:71813909-71813931 CTGGCTGCAGACATGGACCTGGG - Intronic
1129181934 15:73883150-73883172 CTGGATGCTCCCTTGGGGCTGGG - Intronic
1131540305 15:93270022-93270044 CTGGAGGGCCCCTTGGAGCTGGG + Intergenic
1131859259 15:96635174-96635196 ATGGATCCTCACATGAAGCTGGG + Intergenic
1133213480 16:4276016-4276038 CTGGCTGCCCACACTGAACTGGG + Intergenic
1134102504 16:11461966-11461988 CTGGGGGCTCACATGGAGCTTGG + Intronic
1135324012 16:21514431-21514453 CTGGATGGCCATATGGAACTTGG - Intergenic
1136050512 16:27646821-27646843 CTGGGTGACCTCATGGAGCAAGG - Intronic
1136925641 16:34371002-34371024 CTGGATGCCTCAATGGAACTGGG + Intergenic
1136978933 16:35040804-35040826 CTGGATGCCTCAATGGAACTGGG - Intergenic
1141837282 16:86550122-86550144 TTGCCTGCCCACATGCAGCTGGG + Intronic
1142036220 16:87863537-87863559 CTGGATGGCCATATGGAACTTGG - Intronic
1144639863 17:16931330-16931352 CTGGAGGGCCACGTAGAGCTTGG + Intronic
1145270535 17:21402372-21402394 CTGGGGGCCCACATGCTGCTGGG - Intronic
1145302880 17:21653362-21653384 CTGGGTGTCCACTTGGAGCGTGG - Intergenic
1145308744 17:21689768-21689790 CTGGGGGCCCACATGCTGCTGGG - Intergenic
1145917474 17:28583946-28583968 CAGGTTGCTCACCTGGAGCTGGG - Exonic
1147335838 17:39726637-39726659 CTGGATGACCACAAAGCGCTGGG - Exonic
1150796185 17:68239227-68239249 CTGGATGCCAAAAGGGAGTTGGG - Intergenic
1152157043 17:78641311-78641333 CTGGTTGACCAGAGGGAGCTTGG - Intergenic
1155093923 18:22537577-22537599 CTGGAACCCCTCATGGAGCTGGG + Intergenic
1156691549 18:39713278-39713300 CTGGTTGTCCATATTGAGCTTGG - Intergenic
1159823033 18:73170969-73170991 CTGGGTGCACCCATGCAGCTTGG - Intronic
1162353571 19:10166467-10166489 CTGGATGGCCCCATGGAGCCTGG + Intronic
1163011445 19:14429084-14429106 CTGCCTCCCCAGATGGAGCTGGG - Intergenic
1165722389 19:38088789-38088811 CTGGAAGACCACAAGGAGCACGG + Exonic
1167250226 19:48395366-48395388 CTGGATGCCCTCAAGGTCCTTGG - Intronic
1168311484 19:55463221-55463243 GTGGATGCCCAGATGGGGCTAGG + Intergenic
925725035 2:6864384-6864406 GAGGATGCCCCCATGGATCTTGG - Intronic
926160114 2:10481909-10481931 CTGAATGGCCACGTGGAGTTAGG - Intergenic
926887294 2:17609920-17609942 CTTTATCCCCACATGGAGCCCGG + Intronic
927640101 2:24840709-24840731 CTGCAAGCCCACTTGGAGCAGGG + Intronic
929863281 2:45697271-45697293 CTGGCTGCCCACATTCTGCTTGG + Intronic
930002232 2:46869222-46869244 CAGGAGGCACACAGGGAGCTTGG - Intergenic
932573363 2:72949951-72949973 CAGGATGGCCACATGGAGTCTGG + Intronic
932627521 2:73309403-73309425 ATGCCTGCCCACAAGGAGCTTGG - Intergenic
933532612 2:83529728-83529750 CCAGATGCTCAGATGGAGCTTGG + Intergenic
933899356 2:86837948-86837970 CTGGAAGTTCACATGGGGCTGGG - Intronic
935282428 2:101529614-101529636 GGGGATACCCAGATGGAGCTTGG + Intergenic
935781206 2:106511280-106511302 CTGGAAGTTCACATGGGGCTGGG + Intergenic
938290159 2:130144769-130144791 CTCGATCTCCTCATGGAGCTTGG + Exonic
938466370 2:131528176-131528198 CTCGATCTCCTCATGGAGCTTGG - Exonic
938490274 2:131757465-131757487 CTGAGTGCCCTCATGGAGCCTGG + Intronic
938613292 2:132971387-132971409 CTGGATGGGCAGATGGGGCTAGG + Intronic
939456706 2:142446398-142446420 TTGGATGTCCACTGGGAGCTGGG - Intergenic
940044402 2:149393605-149393627 CTGGCTGCCCACAAGGGGCCAGG - Intronic
943092284 2:183389746-183389768 GTGAATGCCCACATGGAGGCAGG - Intergenic
944581699 2:201137666-201137688 CTGGATGCCCACTATGAGGTAGG + Intronic
946337187 2:219045766-219045788 CTGGAAGCCCACATTGTGCCAGG + Intergenic
947208877 2:227687450-227687472 CTGGATTCTCACTTGGAGCAGGG + Exonic
948505530 2:238424999-238425021 CTAAATGCCCACATGGTGCAGGG - Intergenic
1170939779 20:20839369-20839391 CTGGATGCACAGATAGAGCTTGG + Intergenic
1171277201 20:23867476-23867498 CTGGGTGCTCACATGGTGCTGGG - Intergenic
1172276013 20:33679793-33679815 CTGGATGCCCTCAAGGACGTTGG + Exonic
1173431968 20:42996142-42996164 CTGGAAGCACACTTGGTGCTGGG - Intronic
1175608449 20:60330462-60330484 CTGCCTGCCCACCTGGTGCTGGG + Intergenic
1175636080 20:60585415-60585437 ACAGATGCCCTCATGGAGCTTGG - Intergenic
1176063807 20:63183821-63183843 CTGCAGGCCCACCTGGACCTTGG - Intergenic
1176139311 20:63538112-63538134 CTGGAAGCGCCCATGGCGCTGGG + Intergenic
1176707441 21:10126455-10126477 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1176707915 21:10128722-10128744 CTGGATATCCACCTGGGGCTTGG + Intergenic
1178908304 21:36654081-36654103 CTGTGTGCCCACATGGACCCAGG - Intergenic
1180207951 21:46274001-46274023 CTGGCTGCCCACCTGGGGCCTGG + Intronic
1180291384 22:10853132-10853154 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1180494189 22:15882554-15882576 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1180940191 22:19655775-19655797 CTGGTTGCCCACATGGGTCCTGG - Intergenic
1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG + Intronic
1181711421 22:24694257-24694279 CTGGTTGCCCACATGGGTCCTGG + Intergenic
1181960411 22:26618301-26618323 CTGGCTGCCAACATGGGGCAGGG + Intergenic
1182354913 22:29718584-29718606 CTGGTTGCCCACTGGGACCTGGG - Intergenic
1183069224 22:35384618-35384640 CTGGATTCTCTCATGGATCTTGG - Intronic
1183276483 22:36901236-36901258 CTGGCTGTCAACAGGGAGCTGGG - Intergenic
1183346803 22:37312558-37312580 CTGGTTGCCCACATGGGTCCGGG - Intronic
1183821408 22:40348867-40348889 CTGGCAGCCCACAGGCAGCTCGG - Intronic
1184070642 22:42144308-42144330 CTGGAAGTCCACATGCAGCAAGG + Intergenic
1185131815 22:49043661-49043683 CTGGGTGCCCACAGGAACCTGGG - Intergenic
954289687 3:49643043-49643065 CTTGCTGCCCACGTTGAGCTCGG - Exonic
954694367 3:52413030-52413052 GTGGAAGCACACACGGAGCTGGG + Intronic
958023969 3:88028537-88028559 CTGGATGCCCAACAAGAGCTCGG + Intergenic
960619077 3:119621894-119621916 CTGGAGGCCCCAAGGGAGCTAGG - Intronic
961649797 3:128411587-128411609 CTGCCTGCCCACATGGAGTGAGG + Intergenic
961895080 3:130160115-130160137 CTGGATGGGGGCATGGAGCTAGG + Intergenic
962343643 3:134604759-134604781 CAGGATGCACACATACAGCTTGG - Intronic
963271791 3:143292179-143292201 CTGGGTGCTGACATGGTGCTTGG + Intronic
966256857 3:177926918-177926940 TGGAATGTCCACATGGAGCTAGG + Intergenic
1202737737 3_GL000221v1_random:22824-22846 CTGGAGGCCCACATGCAGTGGGG - Intergenic
968603978 4:1522844-1522866 CAGGGTGCCCACATGGGGCAGGG + Intergenic
969005178 4:4013172-4013194 CTGGATGGGGGCATGGAGCTAGG + Intergenic
969665480 4:8554850-8554872 ATGGATGCGCACAAGGAGCAGGG - Intergenic
974314857 4:60266299-60266321 CTGGAACCCCACCTGGAGATGGG + Intergenic
975719560 4:77236597-77236619 CTGGATGCCCACAGGCAGGCAGG - Intronic
978623744 4:110661263-110661285 CTGGATGCCCACAGTGATCCAGG - Intergenic
984858330 4:184215027-184215049 CTGGATGCAGACATAGAACTAGG - Intronic
985379475 4:189377201-189377223 CTGGATGCTCAGCTGGAGGTAGG + Intergenic
985990550 5:3556805-3556827 CTGGAGCCCCTCATGGAGCTTGG + Intergenic
995254900 5:110035062-110035084 CTGGCCTCCCACATGGAGCCAGG - Intergenic
996352455 5:122560615-122560637 CTGGAGCCCCACATGGTGCAGGG - Intergenic
998015152 5:138725764-138725786 CTCTCTGGCCACATGGAGCTGGG + Intronic
998315299 5:141177864-141177886 CTGGAAGTCCACGGGGAGCTTGG + Exonic
998319225 5:141213952-141213974 CTGGAAGTCCACGGGGAGCTTGG + Exonic
998487087 5:142512265-142512287 CTGGTAGCACACATAGAGCTGGG - Intergenic
999422494 5:151456981-151457003 CTGGATGCCCACCTTAAGCCTGG - Intronic
1000051541 5:157567480-157567502 TTAAATGCCCACTTGGAGCTGGG - Intronic
1003461025 6:6328329-6328351 CTGGAAGCCCACATCCAGGTAGG + Intergenic
1007089088 6:39170752-39170774 CTGTAACCCCACCTGGAGCTTGG - Intergenic
1007753367 6:44083326-44083348 CTGGGTGCCCACAGGAAGCTGGG - Intergenic
1008931890 6:56949092-56949114 CTGGATGGCAAAATGGAACTAGG - Intronic
1010294253 6:74177644-74177666 CTGGCTGCATATATGGAGCTGGG - Intergenic
1011047425 6:83100764-83100786 CTGGATGTAGACATTGAGCTAGG - Exonic
1011412327 6:87078773-87078795 GTGGATGTCCATATGGGGCTTGG + Intergenic
1011627622 6:89296406-89296428 CTGGATGCCCAGATGTCACTTGG - Intronic
1013318308 6:108962268-108962290 CAGGATGCCAAGATGGACCTAGG + Intronic
1013393685 6:109713262-109713284 GTGAATGCCCACATGGAGGCAGG - Intronic
1015378999 6:132545444-132545466 ATGGTTGCCCACATTGAGCAAGG + Intergenic
1017791721 6:157805474-157805496 CTGGGAGCCCACATGGAGGCAGG - Intronic
1020382068 7:7557527-7557549 ATGAATGCCCACATGGAGGCAGG + Intergenic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1025023926 7:55500466-55500488 CTGCATTCTCACCTGGAGCTTGG - Intronic
1026401650 7:70020305-70020327 CTGCATCCCCACATAGAGCCAGG + Intronic
1027927996 7:84492514-84492536 CTGGAGGGCAACCTGGAGCTAGG - Intronic
1028672450 7:93418804-93418826 CTGGATGTCCACCAGGAGATTGG - Intergenic
1031134733 7:117873051-117873073 CTGGACGCAGACAGGGAGCTGGG + Intronic
1032540693 7:132700477-132700499 CTGGATGCCCTCCTGCACCTGGG - Intronic
1034872651 7:154697376-154697398 CTGGAGGCCTACATGGGACTTGG - Intronic
1035355058 7:158271530-158271552 CTGGATTGCCCCATGGGGCTTGG - Intronic
1035604242 8:919280-919302 CTAGGTGCCCTCATGGTGCTGGG + Intergenic
1036370756 8:8161153-8161175 CTGGATGGGGGCATGGAGCTAGG - Intergenic
1036645690 8:10610560-10610582 CTGGGAGCTCACATGGAGCCAGG - Exonic
1036880137 8:12504477-12504499 CTGGATGGGGGCATGGAGCTAGG + Intergenic
1042199812 8:66270307-66270329 CTTGCTGCCCTCATGGAGCCTGG - Intergenic
1047275458 8:123401937-123401959 CTGGATGCCCACTATGAGGTAGG - Intronic
1049218043 8:141416752-141416774 CTGCTTGCCCACCTGGAGGTGGG + Intronic
1049338868 8:142101236-142101258 CTGGGTGCACACTTGGAGCCAGG + Intergenic
1049556617 8:143285578-143285600 CTGGATGGGCACATGGACCGAGG - Intergenic
1049758126 8:144319848-144319870 CTGGCTGACCACCCGGAGCTCGG + Intronic
1050797543 9:9562896-9562918 ATGTCTGCCCACATGGAGCTTGG - Intronic
1052941237 9:34133307-34133329 CTGGATGCCCACTATGAGGTAGG + Intergenic
1053644635 9:40113193-40113215 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1053760872 9:41349394-41349416 CTGGATATCCACCTGGGGCTTGG - Intergenic
1053761347 9:41351658-41351680 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1054325658 9:63711073-63711095 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1054350121 9:64013203-64013225 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1054539941 9:66262776-66262798 CTGAGTGCCCTCATGGAGCCTGG - Intergenic
1055326451 9:75135767-75135789 CTGGATTCTCATCTGGAGCTTGG + Intronic
1056771976 9:89484156-89484178 CTGCAGGCCCACCTGCAGCTGGG + Intronic
1057103465 9:92387628-92387650 CTTGATGCCCACATGGTGGAAGG - Intronic
1059418533 9:114176715-114176737 CTGGATGCTCAGAGGTAGCTGGG + Intronic
1061745134 9:132733966-132733988 CAGGGTGCCCACCTGGAGCAGGG - Intronic
1062717790 9:138019669-138019691 CTGGCAGCCAGCATGGAGCTGGG + Intronic
1202792189 9_KI270719v1_random:95335-95357 CTGAGTGCCCTCATGGAGCCTGG + Intergenic
1202792660 9_KI270719v1_random:97602-97624 CTGGATATCCACCTGGGGCTTGG + Intergenic
1203706465 Un_KI270742v1:53268-53290 CTGGAGGCCCACATGCAGTGGGG - Intergenic
1185933412 X:4228773-4228795 CTGGCTGGTCTCATGGAGCTTGG + Intergenic
1190071414 X:47282979-47283001 CTGGAAACCCACTGGGAGCTTGG - Intergenic
1190254991 X:48755535-48755557 GTCCCTGCCCACATGGAGCTGGG - Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1191943118 X:66501082-66501104 AAGAATGCCCATATGGAGCTTGG + Intergenic
1192011556 X:67278284-67278306 GTGAATGCCCACATGGAGGCAGG + Intergenic
1192263190 X:69521078-69521100 CTGGAAGCTGACAAGGAGCTGGG - Intronic
1193709392 X:84860873-84860895 CTGGATGCCGACAAGAACCTGGG + Intergenic
1194055417 X:89126700-89126722 GTGGATGCCCACAGGGAGGCAGG - Intergenic
1194781254 X:98028239-98028261 GTGAATGCCCACAGGGAGTTGGG - Intergenic
1196455960 X:115891807-115891829 CTGGATGCTGCCTTGGAGCTTGG + Intergenic
1196831049 X:119775834-119775856 CTGGAGGCCCACGAGGAGCTAGG - Intergenic
1196887363 X:120260937-120260959 CTTGAGGACCACATGTAGCTGGG + Exonic
1198028857 X:132735655-132735677 CTGGATGCCCACATGGAGCTGGG + Intronic
1200226816 X:154422125-154422147 GGGGTTGCCCAGATGGAGCTGGG + Intergenic