ID: 1198031284

View in Genome Browser
Species Human (GRCh38)
Location X:132755883-132755905
Sequence CCAACAAGGCCCAAACTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198031284_1198031290 3 Left 1198031284 X:132755883-132755905 CCCTTTAGTTTGGGCCTTGTTGG No data
Right 1198031290 X:132755909-132755931 GCAATCTGGCTTCAGGTCAGTGG No data
1198031284_1198031289 -4 Left 1198031284 X:132755883-132755905 CCCTTTAGTTTGGGCCTTGTTGG No data
Right 1198031289 X:132755902-132755924 TTGGAAAGCAATCTGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198031284 Original CRISPR CCAACAAGGCCCAAACTAAA GGG (reversed) Intronic