ID: 1198031284 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:132755883-132755905 |
Sequence | CCAACAAGGCCCAAACTAAA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1198031284_1198031290 | 3 | Left | 1198031284 | X:132755883-132755905 | CCCTTTAGTTTGGGCCTTGTTGG | No data | ||
Right | 1198031290 | X:132755909-132755931 | GCAATCTGGCTTCAGGTCAGTGG | No data | ||||
1198031284_1198031289 | -4 | Left | 1198031284 | X:132755883-132755905 | CCCTTTAGTTTGGGCCTTGTTGG | No data | ||
Right | 1198031289 | X:132755902-132755924 | TTGGAAAGCAATCTGGCTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1198031284 | Original CRISPR | CCAACAAGGCCCAAACTAAA GGG (reversed) | Intronic | ||