ID: 1198033535

View in Genome Browser
Species Human (GRCh38)
Location X:132779033-132779055
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198033535_1198033545 18 Left 1198033535 X:132779033-132779055 CCACCTGCCTGAGCAGCACAGGG No data
Right 1198033545 X:132779074-132779096 AAACTGCCAGCAGGGAATGGAGG No data
1198033535_1198033544 15 Left 1198033535 X:132779033-132779055 CCACCTGCCTGAGCAGCACAGGG No data
Right 1198033544 X:132779071-132779093 CACAAACTGCCAGCAGGGAATGG No data
1198033535_1198033542 9 Left 1198033535 X:132779033-132779055 CCACCTGCCTGAGCAGCACAGGG No data
Right 1198033542 X:132779065-132779087 GGGGTGCACAAACTGCCAGCAGG No data
1198033535_1198033543 10 Left 1198033535 X:132779033-132779055 CCACCTGCCTGAGCAGCACAGGG No data
Right 1198033543 X:132779066-132779088 GGGTGCACAAACTGCCAGCAGGG No data
1198033535_1198033546 23 Left 1198033535 X:132779033-132779055 CCACCTGCCTGAGCAGCACAGGG No data
Right 1198033546 X:132779079-132779101 GCCAGCAGGGAATGGAGGACTGG No data
1198033535_1198033541 -10 Left 1198033535 X:132779033-132779055 CCACCTGCCTGAGCAGCACAGGG No data
Right 1198033541 X:132779046-132779068 CAGCACAGGGAAAAGCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198033535 Original CRISPR CCCTGTGCTGCTCAGGCAGG TGG (reversed) Intronic