ID: 1198033537

View in Genome Browser
Species Human (GRCh38)
Location X:132779036-132779058
Sequence TTTCCCTGTGCTGCTCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198033537_1198033544 12 Left 1198033537 X:132779036-132779058 CCTGCCTGAGCAGCACAGGGAAA No data
Right 1198033544 X:132779071-132779093 CACAAACTGCCAGCAGGGAATGG No data
1198033537_1198033545 15 Left 1198033537 X:132779036-132779058 CCTGCCTGAGCAGCACAGGGAAA No data
Right 1198033545 X:132779074-132779096 AAACTGCCAGCAGGGAATGGAGG No data
1198033537_1198033543 7 Left 1198033537 X:132779036-132779058 CCTGCCTGAGCAGCACAGGGAAA No data
Right 1198033543 X:132779066-132779088 GGGTGCACAAACTGCCAGCAGGG No data
1198033537_1198033546 20 Left 1198033537 X:132779036-132779058 CCTGCCTGAGCAGCACAGGGAAA No data
Right 1198033546 X:132779079-132779101 GCCAGCAGGGAATGGAGGACTGG No data
1198033537_1198033542 6 Left 1198033537 X:132779036-132779058 CCTGCCTGAGCAGCACAGGGAAA No data
Right 1198033542 X:132779065-132779087 GGGGTGCACAAACTGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198033537 Original CRISPR TTTCCCTGTGCTGCTCAGGC AGG (reversed) Intronic