ID: 1198033538

View in Genome Browser
Species Human (GRCh38)
Location X:132779040-132779062
Sequence TGCTTTTCCCTGTGCTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198033538_1198033546 16 Left 1198033538 X:132779040-132779062 CCTGAGCAGCACAGGGAAAAGCA No data
Right 1198033546 X:132779079-132779101 GCCAGCAGGGAATGGAGGACTGG No data
1198033538_1198033543 3 Left 1198033538 X:132779040-132779062 CCTGAGCAGCACAGGGAAAAGCA No data
Right 1198033543 X:132779066-132779088 GGGTGCACAAACTGCCAGCAGGG No data
1198033538_1198033548 30 Left 1198033538 X:132779040-132779062 CCTGAGCAGCACAGGGAAAAGCA No data
Right 1198033548 X:132779093-132779115 GAGGACTGGATCAAGTCACAAGG No data
1198033538_1198033544 8 Left 1198033538 X:132779040-132779062 CCTGAGCAGCACAGGGAAAAGCA No data
Right 1198033544 X:132779071-132779093 CACAAACTGCCAGCAGGGAATGG No data
1198033538_1198033545 11 Left 1198033538 X:132779040-132779062 CCTGAGCAGCACAGGGAAAAGCA No data
Right 1198033545 X:132779074-132779096 AAACTGCCAGCAGGGAATGGAGG No data
1198033538_1198033542 2 Left 1198033538 X:132779040-132779062 CCTGAGCAGCACAGGGAAAAGCA No data
Right 1198033542 X:132779065-132779087 GGGGTGCACAAACTGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198033538 Original CRISPR TGCTTTTCCCTGTGCTGCTC AGG (reversed) Intronic