ID: 1198033541

View in Genome Browser
Species Human (GRCh38)
Location X:132779046-132779068
Sequence CAGCACAGGGAAAAGCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198033535_1198033541 -10 Left 1198033535 X:132779033-132779055 CCACCTGCCTGAGCAGCACAGGG No data
Right 1198033541 X:132779046-132779068 CAGCACAGGGAAAAGCAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198033541 Original CRISPR CAGCACAGGGAAAAGCAAAG GGG Intronic