ID: 1198033543

View in Genome Browser
Species Human (GRCh38)
Location X:132779066-132779088
Sequence GGGTGCACAAACTGCCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198033537_1198033543 7 Left 1198033537 X:132779036-132779058 CCTGCCTGAGCAGCACAGGGAAA 0: 1
1: 7
2: 390
3: 5108
4: 36879
Right 1198033543 X:132779066-132779088 GGGTGCACAAACTGCCAGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 111
1198033535_1198033543 10 Left 1198033535 X:132779033-132779055 CCACCTGCCTGAGCAGCACAGGG 0: 1
1: 0
2: 3
3: 54
4: 719
Right 1198033543 X:132779066-132779088 GGGTGCACAAACTGCCAGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 111
1198033538_1198033543 3 Left 1198033538 X:132779040-132779062 CCTGAGCAGCACAGGGAAAAGCA 0: 1
1: 0
2: 1
3: 40
4: 341
Right 1198033543 X:132779066-132779088 GGGTGCACAAACTGCCAGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198033543 Original CRISPR GGGTGCACAAACTGCCAGCA GGG Intronic
900139334 1:1132978-1133000 GGGGGCACAACCTGCCAGAGGGG + Intergenic
900161346 1:1225426-1225448 GGGTGCACACACCGCAGGCACGG + Intronic
900429114 1:2593613-2593635 GGGGGCACTGACTCCCAGCATGG - Intronic
901251960 1:7785358-7785380 GGGAACACAAACTGCAAGCCAGG - Intronic
901857686 1:12054678-12054700 GCCTGCAGAAAGTGCCAGCAGGG - Intergenic
902539306 1:17141595-17141617 GGGGGCACAAAGTGGCAGAAGGG - Intergenic
902613505 1:17610687-17610709 GTGGGCACAAGCTGACAGCAGGG + Intronic
902992215 1:20196288-20196310 GGGTGCCCACCCTGCCAGCTGGG + Intergenic
906152525 1:43595916-43595938 GGGGGCAGAAACAGGCAGCATGG + Intronic
910133192 1:83933834-83933856 GGGCCCACAAACTGGCAGCCTGG + Intronic
914518834 1:148397549-148397571 GGTTGCATAAGCTGCCATCATGG + Intergenic
915553554 1:156648638-156648660 GGGTGCAGAGATTGCCACCACGG + Exonic
916391704 1:164338134-164338156 GTGTACACAAACTTCCAGCAGGG - Intergenic
917846369 1:179023956-179023978 GGGGGCAGAAACTGACATCATGG + Intergenic
917977512 1:180249816-180249838 GGGTGCACTCACTGTCACCACGG + Intronic
922478987 1:225925423-225925445 GGGTGCACAAACTGAGGGCCTGG - Intergenic
1067693570 10:48519815-48519837 GGGGGAACACAGTGCCAGCAAGG + Intronic
1069900426 10:71703738-71703760 AGGTCCCCAAACTCCCAGCAGGG + Intronic
1070895449 10:79980163-79980185 GGTTGCACATGATGCCAGCAAGG - Intronic
1075934895 10:126331950-126331972 GGGTGCAACCACTGGCAGCATGG + Intronic
1076890375 10:133280466-133280488 AGGTGGCCAAACTGCCAGCCTGG - Intronic
1077236012 11:1482357-1482379 GGGGGCAGGAACTGCCAGTAGGG - Intronic
1079084822 11:17437771-17437793 GGCTGCACCAACTGGCAGAAGGG + Intronic
1080683609 11:34497568-34497590 GGGTGCACCAGATGCCCGCAGGG + Intronic
1087237476 11:95736175-95736197 GGGTGGAAAAACTGCCTGCCAGG - Intergenic
1089384763 11:118060321-118060343 GGGTGCTCACACTCACAGCATGG - Intergenic
1090846722 11:130535787-130535809 GGGTGCAGAAACAGCCAGACTGG - Intergenic
1095942332 12:47735375-47735397 GGCAGCACAAACTCCCAGCATGG + Intronic
1096647534 12:53047022-53047044 GGGTGCGCAGACGGCCAGCCGGG - Intronic
1098486315 12:71025895-71025917 GGGAGCACACACTGGCAGCATGG + Intergenic
1102316972 12:111896350-111896372 GTGTTCACAAACTTCCAGCTTGG - Intronic
1103037425 12:117667701-117667723 AGGTGCACAAAGTTACAGCAGGG + Intronic
1104348219 12:128021716-128021738 GGGTGCTCAAGCTGGCACCATGG - Intergenic
1105899609 13:24743806-24743828 GGCTGCACAACCTGCAGGCATGG - Intergenic
1113438031 13:110307885-110307907 GAGTGGACGAACCGCCAGCATGG + Exonic
1114527253 14:23374304-23374326 GGGTTCACAGACTCCCAGCAAGG - Intronic
1117485835 14:56195813-56195835 TGGGGCCCAAACTGCCAGCTGGG - Intronic
1119298566 14:73552784-73552806 GGGTTGACAAACTGCCAGGCTGG - Intronic
1119302863 14:73584971-73584993 GGGTTGACAAACTGCCAGGCTGG - Intergenic
1119852293 14:77874726-77874748 GGGTGAACAAGCTACCATCAGGG + Intronic
1124256076 15:28144090-28144112 CTGTGCACAAGCTGCCAGCGAGG + Exonic
1124568174 15:30835051-30835073 CTGTGCACAAGCTGCCAGCAAGG - Intergenic
1127453868 15:59140749-59140771 GGGAACACTGACTGCCAGCAGGG + Intronic
1129704751 15:77787711-77787733 TGGAGCCTAAACTGCCAGCAAGG - Intronic
1129767502 15:78179487-78179509 GCGGGCACAAAGTACCAGCAAGG + Intronic
1139150903 16:64381139-64381161 GAGTGCACACACTCCCAGCCAGG - Intergenic
1140517568 16:75555560-75555582 GGGCGCACACGCTGACAGCATGG + Intronic
1141627505 16:85268974-85268996 GGCTGCAGAAAATGCCAGGAGGG + Intergenic
1142072649 16:88099664-88099686 GGGTGCACCAACTGGCAGCCTGG + Intronic
1146842572 17:36166152-36166174 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146854884 17:36254111-36254133 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146865736 17:36334265-36334287 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1146870784 17:36378003-36378025 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147068606 17:37934877-37934899 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1147073668 17:37978627-37978649 GGGTGTTCAGCCTGCCAGCAGGG + Intronic
1147080128 17:38014414-38014436 GGGTGTTCAGCCTGCCAGCAGGG - Intronic
1147085189 17:38058165-38058187 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1147096077 17:38138374-38138396 GGGTGTTCAGCCTGCCAGCAGGG - Intergenic
1147101135 17:38182131-38182153 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1152181504 17:78824811-78824833 GGGTTCAGAAAGTGACAGCAAGG + Intronic
1156447209 18:37246213-37246235 GTGTGAAAAACCTGCCAGCATGG - Intronic
1160610636 18:80082251-80082273 GTGTGCCCCACCTGCCAGCACGG - Intronic
1161262169 19:3344100-3344122 GGTTCCAGGAACTGCCAGCAGGG + Intergenic
1166526175 19:43511436-43511458 GGGCGGACAGACTTCCAGCAAGG - Exonic
1168427889 19:56253521-56253543 GGGTGCACAGACTGCCACCCAGG - Intronic
925158768 2:1667016-1667038 GTGTGCTCCCACTGCCAGCATGG - Intronic
925862901 2:8197686-8197708 GGCTTCAAAACCTGCCAGCATGG - Intergenic
930026448 2:47032001-47032023 AGGGGCACACACTGCCCGCAGGG - Intronic
934981929 2:98849990-98850012 GGCTGCAGAAACCGACAGCAGGG - Intronic
935340838 2:102058459-102058481 GGATGCACACACTGCCACCTTGG - Intergenic
1170030381 20:11938060-11938082 GGGTGCACACAATGGCTGCATGG + Intergenic
1170698052 20:18678108-18678130 AGGTTCACTAAATGCCAGCAGGG + Intronic
1171449475 20:25225695-25225717 GTGTGCAGAAAGTGCCAGCACGG - Exonic
1174165943 20:48583698-48583720 GTGTACAAAAACTGCCAGCTGGG + Intergenic
1175706595 20:61183167-61183189 GGGTCCCCAGCCTGCCAGCAAGG + Intergenic
1179072636 21:38086370-38086392 GGGAGGACAAACTACAAGCAGGG - Intronic
1179470306 21:41605799-41605821 GGGCGCACACACTGCCGGCAGGG + Intergenic
1179726739 21:43345194-43345216 TGGTGCAAACACTCCCAGCATGG - Intergenic
1180986350 22:19906174-19906196 TGCTGCACAAATCGCCAGCATGG - Intronic
1181078193 22:20395219-20395241 GGAGGCAGAACCTGCCAGCAAGG - Intronic
1181566490 22:23741945-23741967 GGATGCACAAAAACCCAGCATGG + Exonic
1183521545 22:38298599-38298621 GGTGGCACAAGCTGTCAGCACGG + Intronic
950499096 3:13352743-13352765 GGGTGCAGCAACTGCCGGCAGGG + Intronic
950669080 3:14514430-14514452 GTGTGCACAATCTGCCCGCCCGG + Exonic
954082324 3:48219864-48219886 GGATGAACAAACTGCCTGCTTGG + Intergenic
962929316 3:140022562-140022584 GGCTGCACAATGAGCCAGCAAGG + Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970824565 4:20254823-20254845 GGGCGCAGAAACTGCCAGAAAGG - Intronic
981657134 4:147124611-147124633 GGGTGCAGAGGCTGCCATCAAGG - Intergenic
986698977 5:10386418-10386440 GGGTGAACGAACTGCTATCAAGG - Intronic
991335242 5:65539805-65539827 GGGTGCAGAAAGTGCAAGCCAGG - Intronic
995610888 5:113909303-113909325 GGGTGCAGAACCCACCAGCATGG - Intergenic
998990620 5:147811747-147811769 GTGTGCACACAGGGCCAGCAAGG + Intergenic
1000756431 5:165166934-165166956 GTGTGCACAAAATGACAGAAAGG - Intergenic
1001316133 5:170642360-170642382 CTGTGCACACAGTGCCAGCAAGG + Intronic
1001515354 5:172351573-172351595 TGGTGCAAATACTGCCACCATGG - Intronic
1003469046 6:6411375-6411397 GGGTGTACATACTCCCTGCATGG - Intergenic
1009195935 6:60684428-60684450 GAGTGCACAAGCTGAGAGCAAGG + Intergenic
1009863323 6:69364192-69364214 GTTTTCACAAACTGCCAGCATGG + Intronic
1012491924 6:99791867-99791889 GGCTGAACAAATTGCCAGCATGG - Intergenic
1015970974 6:138742077-138742099 GGGTATAGACACTGCCAGCAGGG - Intergenic
1017950660 6:159132531-159132553 GGGTACACAAACTGCTGTCAAGG + Intergenic
1017999698 6:159568359-159568381 TGGTGCACAAACTGCTGCCAGGG + Intergenic
1019448808 7:1085446-1085468 GGTTGCAGAAACTGACTGCAGGG - Intronic
1025998234 7:66541916-66541938 CCGTGCACAAGCTGCCAGAATGG - Intergenic
1030172416 7:106616595-106616617 GGGTGCAAACACTGACAACAAGG + Intergenic
1036180572 8:6580771-6580793 GGATGCACTAACTACCATCATGG - Intronic
1039923384 8:41908367-41908389 AGGTGCCCAGACAGCCAGCAGGG - Intergenic
1043288682 8:78568775-78568797 AGGTGTACATACTGCCAGAAAGG - Intronic
1044435131 8:92152977-92152999 AGATGCAGAAACTGCCAGCCAGG - Intergenic
1044525952 8:93251176-93251198 GTGTGCACAAAATGCCAGTTTGG - Intergenic
1046818183 8:118608268-118608290 AGATGCACAACCAGCCAGCAAGG - Intronic
1053111455 9:35463755-35463777 GGGGGCAGACATTGCCAGCAAGG - Intergenic
1055231317 9:74070133-74070155 AGGTGCACATCCTGACAGCAGGG - Intergenic
1057819073 9:98317419-98317441 GGCTGCACAAACTGACAGGCAGG + Intronic
1058940926 9:109812106-109812128 AGGGGCAGAAACTGCCAACAGGG + Intronic
1060971400 9:127740189-127740211 GGTTGCAAAGACTCCCAGCATGG - Intronic
1061407347 9:130399693-130399715 GGGTGCTCTCCCTGCCAGCAGGG + Intronic
1061962509 9:133995249-133995271 GGGAGCAAGAAGTGCCAGCATGG + Intergenic
1191253896 X:58271615-58271637 GGGTGCAGTATCTGCCAGGAAGG + Intergenic
1191255987 X:58279839-58279861 GGGTGCAGCAGCTGCCAGGAAGG + Intergenic
1194872731 X:99153156-99153178 GGCTGCACAAGCTTGCAGCATGG + Intergenic
1198033543 X:132779066-132779088 GGGTGCACAAACTGCCAGCAGGG + Intronic
1199863478 X:151822453-151822475 GGGTGGGAAAACTGCAAGCAGGG + Intergenic