ID: 1198033544

View in Genome Browser
Species Human (GRCh38)
Location X:132779071-132779093
Sequence CACAAACTGCCAGCAGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198033537_1198033544 12 Left 1198033537 X:132779036-132779058 CCTGCCTGAGCAGCACAGGGAAA No data
Right 1198033544 X:132779071-132779093 CACAAACTGCCAGCAGGGAATGG No data
1198033535_1198033544 15 Left 1198033535 X:132779033-132779055 CCACCTGCCTGAGCAGCACAGGG No data
Right 1198033544 X:132779071-132779093 CACAAACTGCCAGCAGGGAATGG No data
1198033538_1198033544 8 Left 1198033538 X:132779040-132779062 CCTGAGCAGCACAGGGAAAAGCA No data
Right 1198033544 X:132779071-132779093 CACAAACTGCCAGCAGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198033544 Original CRISPR CACAAACTGCCAGCAGGGAA TGG Intronic