ID: 1198035082

View in Genome Browser
Species Human (GRCh38)
Location X:132794003-132794025
Sequence AAGGCTACTTGCCGTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198035078_1198035082 10 Left 1198035078 X:132793970-132793992 CCATTTGTAAAATTAGCAATTTC 0: 1
1: 0
2: 4
3: 60
4: 454
Right 1198035082 X:132794003-132794025 AAGGCTACTTGCCGTTTTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 47
1198035076_1198035082 28 Left 1198035076 X:132793952-132793974 CCACGTTTCACCACTCTGCCATT 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1198035082 X:132794003-132794025 AAGGCTACTTGCCGTTTTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 47
1198035077_1198035082 18 Left 1198035077 X:132793962-132793984 CCACTCTGCCATTTGTAAAATTA 0: 1
1: 1
2: 1
3: 39
4: 321
Right 1198035082 X:132794003-132794025 AAGGCTACTTGCCGTTTTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198035082 Original CRISPR AAGGCTACTTGCCGTTTTGC TGG Intronic
902851016 1:19156773-19156795 AAGACTACTTGGCGGTTTGTGGG - Exonic
920895544 1:210045502-210045524 AATGCTACTAGCGGTTTTGAAGG + Intronic
923548455 1:234942125-234942147 AAGGCAACTTTCCGTTGTGACGG - Intergenic
1064766401 10:18678729-18678751 AAGGCTATTTTACATTTTGCCGG + Exonic
1072873253 10:99143658-99143680 AAGGCTGCTTGCAGACTTGCTGG - Intronic
1098228424 12:68348471-68348493 AAGGCTAGCTGCTGTTTTGGGGG - Intergenic
1099934023 12:89104524-89104546 TTGGCTGCTTGCCGTGTTGCTGG - Intergenic
1100071181 12:90720562-90720584 AAGGTTACTTGCCAATGTGCTGG - Intergenic
1102786426 12:115608666-115608688 AAGGCAGCTTGTAGTTTTGCAGG - Intergenic
1107030644 13:35850141-35850163 AAAGCTACTTACTGTTTTGTGGG - Intronic
1114955531 14:27813506-27813528 AAGGCAGCCTCCCGTTTTGCTGG + Intergenic
1117427564 14:55616552-55616574 AATGCTTCTTGCCTTTTTGATGG - Exonic
1119151728 14:72366538-72366560 AAGGCTCATTGGCTTTTTGCAGG + Intronic
1202848460 14_GL000225v1_random:1142-1164 AAGACTCCTTGCCCTTGTGCCGG - Intergenic
1124237334 15:28002148-28002170 AAGCCTAGTTGCCATTTTTCTGG - Intronic
1128379749 15:67103893-67103915 GAGGCTATTTGCCGTATTGAAGG + Intronic
1135043678 16:19136928-19136950 AAGGCTCATTGCAGTGTTGCTGG - Intronic
1136864767 16:33738243-33738265 AAGCTTCATTGCCGTTTTGCCGG + Intergenic
1141295081 16:82760260-82760282 CAGGCTAATTGCATTTTTGCGGG - Intronic
1203126264 16_KI270728v1_random:1586379-1586401 AAGCTTCATTGCCGTTTTGCCGG + Intergenic
1146051833 17:29560377-29560399 TAGGCTGCTTCCCATTTTGCAGG + Intergenic
1147214940 17:38893578-38893600 AAGGGTACTGCCCTTTTTGCAGG + Intronic
925323778 2:2999239-2999261 AAGCCTAATTGCCTTATTGCGGG - Intergenic
927744767 2:25608327-25608349 TAGGCTATTTGCCTTTTTTCAGG - Intronic
934659889 2:96137825-96137847 AAGGCTCCTTGGCTTTGTGCTGG - Intronic
940205692 2:151199070-151199092 TAGGCTACTTGCCGTTTGCCTGG - Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1172347422 20:34214018-34214040 AAGGCTTCTTTCCTTTCTGCCGG + Intronic
951363615 3:21753470-21753492 AAGGCTACATGCTGTTTTTTGGG - Intronic
955469907 3:59275580-59275602 AAAGCTACTGGCCATTTTGAAGG - Intergenic
959306573 3:104674339-104674361 AAGGTAACTTGCCCTTTTGATGG + Intergenic
959652007 3:108759178-108759200 AAGCATCCTTGCCTTTTTGCTGG - Intergenic
960200440 3:114828666-114828688 ATGGCTACTAGCCATTATGCAGG + Intronic
960522592 3:118672708-118672730 AAGTGTACTTGCTGTTCTGCAGG + Intergenic
981189311 4:141841988-141842010 AAGGATACTTGTCATTTTTCTGG + Intergenic
981854166 4:149267674-149267696 AAGGCTACTTCTAGTTTGGCTGG - Intergenic
982308087 4:153954649-153954671 AAGGCTAATTGAAGTTTTGGAGG + Intergenic
997278037 5:132614788-132614810 AAGGCTACTTTCATTTTTCCTGG - Intronic
1003558750 6:7163941-7163963 AAGAGTACTTGCCGTTTGGCCGG + Intronic
1016362855 6:143286789-143286811 CAGGCTGCTGGCTGTTTTGCTGG + Intronic
1030619161 7:111770546-111770568 CAGGATACTTGCCATTCTGCAGG + Intronic
1031558841 7:123211745-123211767 ACGGCTACTAGGGGTTTTGCTGG + Intergenic
1035298064 7:157878020-157878042 AAGGCTACTTGGCGGTGTTCCGG + Intronic
1047217393 8:122887708-122887730 ACGGCTCCTTGCCCTTTTCCGGG - Intronic
1052229718 9:26134610-26134632 AAGGCTACTTGCTGCCTGGCTGG + Intergenic
1057162451 9:92898019-92898041 AAGGCTTCTTTGCATTTTGCAGG - Intergenic
1057742317 9:97722524-97722546 AAGGCCACTTGACCTTCTGCAGG + Intergenic
1190152664 X:47960820-47960842 GAGGCTAGGTGCAGTTTTGCAGG + Intronic
1193867445 X:86752605-86752627 AAGGCTATTTGATTTTTTGCAGG + Intronic
1198035082 X:132794003-132794025 AAGGCTACTTGCCGTTTTGCTGG + Intronic