ID: 1198035181

View in Genome Browser
Species Human (GRCh38)
Location X:132794900-132794922
Sequence AGGTGGCCCCCAGTACTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198035181_1198035188 8 Left 1198035181 X:132794900-132794922 CCCCGAAGTACTGGGGGCCACCT No data
Right 1198035188 X:132794931-132794953 TCACCTTGTCTCGTATGCATGGG No data
1198035181_1198035187 7 Left 1198035181 X:132794900-132794922 CCCCGAAGTACTGGGGGCCACCT No data
Right 1198035187 X:132794930-132794952 GTCACCTTGTCTCGTATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198035181 Original CRISPR AGGTGGCCCCCAGTACTTCG GGG (reversed) Intronic