ID: 1198036735

View in Genome Browser
Species Human (GRCh38)
Location X:132808416-132808438
Sequence CTCCCATGACACATGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198036735_1198036743 6 Left 1198036735 X:132808416-132808438 CCCAGCCCCATGTGTCATGGGAG 0: 1
1: 0
2: 4
3: 18
4: 169
Right 1198036743 X:132808445-132808467 ATCAGGCTACCCCACTTGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 78
1198036735_1198036745 14 Left 1198036735 X:132808416-132808438 CCCAGCCCCATGTGTCATGGGAG 0: 1
1: 0
2: 4
3: 18
4: 169
Right 1198036745 X:132808453-132808475 ACCCCACTTGCCTGGGCTCATGG 0: 1
1: 0
2: 2
3: 26
4: 318
1198036735_1198036744 7 Left 1198036735 X:132808416-132808438 CCCAGCCCCATGTGTCATGGGAG 0: 1
1: 0
2: 4
3: 18
4: 169
Right 1198036744 X:132808446-132808468 TCAGGCTACCCCACTTGCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198036735 Original CRISPR CTCCCATGACACATGGGGCT GGG (reversed) Intronic
902242717 1:15099593-15099615 CCCCCAACGCACATGGGGCTTGG - Intronic
903032249 1:20472329-20472351 CAGCAATGACACATGGGCCTTGG + Intergenic
903780590 1:25817860-25817882 CTCCCAGGACACAGGGAGCCTGG - Exonic
905237436 1:36559890-36559912 CTCCCATCACAGAAGAGGCTGGG - Intergenic
905853310 1:41290306-41290328 CTCCCTAGACCCATGGGGCTGGG - Intergenic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
912006070 1:104903229-104903251 CTCCCATGACATATGGGGATTGG + Intergenic
912372483 1:109184771-109184793 CTCCCTTGCCCCATGGGGCGGGG + Intronic
917254336 1:173098270-173098292 CTCCCATGACACAGCTGGTTTGG - Intergenic
920296650 1:204961531-204961553 CTCCAGTGACACATGTTGCTGGG + Intronic
920451954 1:206065984-206066006 CTGCCATGACACACAGGGCCCGG + Intronic
920664456 1:207951368-207951390 CTACCATGTCACCTGGGGCAAGG - Intergenic
921861727 1:220048097-220048119 CTCCCATGAGACTTGAGGCCAGG + Intergenic
923128843 1:231057316-231057338 CTCCCCTGACACGTGGGGATGGG + Intergenic
923620516 1:235575614-235575636 CTCCCAGGACAAATGAGACTGGG + Intronic
924077742 1:240358756-240358778 CTCCCATGACACATGGATTATGG + Intronic
924099626 1:240589999-240590021 CTCCCAGGACACATGGTGGGAGG + Intronic
1063565762 10:7171458-7171480 CTCACACCACCCATGGGGCTAGG + Intronic
1064777185 10:18792041-18792063 CTCCCCAGCCACGTGGGGCTGGG - Intergenic
1072619290 10:97068887-97068909 CTCTCAAGACATATGGGGCTGGG - Intronic
1074489561 10:113927027-113927049 CTCACATGGCAGAAGGGGCTAGG - Intergenic
1075899841 10:126032322-126032344 CTCCCATCACACATAGGGAACGG - Intronic
1076107701 10:127836415-127836437 CTGCCATCACACATGGGCCTCGG - Intergenic
1076894551 10:133303446-133303468 CTCCCTCCACACATGGGTCTGGG + Intronic
1081402728 11:42661733-42661755 ATCCCTTTACAAATGGGGCTAGG + Intergenic
1083160526 11:60851487-60851509 CCTCCAGGCCACATGGGGCTGGG - Exonic
1083889220 11:65587654-65587676 CTCCCAGGTCACACAGGGCTGGG + Intronic
1085688377 11:78646392-78646414 CACTCACGACTCATGGGGCTTGG - Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1090498662 11:127240210-127240232 CTCCGATGGCCCATGGGGGTGGG + Intergenic
1091695898 12:2627861-2627883 CTCCTAGGACACATGGGTCACGG - Intronic
1091708233 12:2715205-2715227 CTCCCTTAAAACATGGGGATTGG - Intergenic
1094497038 12:30995020-30995042 CACCCATGGCACATGGGCCGGGG + Exonic
1096100489 12:48968068-48968090 CCCCCAGGACACATGGGAATGGG - Exonic
1098018432 12:66130662-66130684 GTCCAGTGACACATGGGACTTGG - Intronic
1100285834 12:93165501-93165523 CTTCCATGACACATGGGATTTGG + Intergenic
1103291243 12:119848061-119848083 CTTCCTTGAGACATGGGGCATGG - Intronic
1104453038 12:128886745-128886767 TTCCCAGGACCCATGAGGCTGGG - Intronic
1104897113 12:132169719-132169741 CTCCCATGGCACCTGGGTCCTGG + Intergenic
1105544574 13:21342219-21342241 CTCCTCTGCCACCTGGGGCTGGG - Intergenic
1110936592 13:81298170-81298192 ATCCCTTGACAAGTGGGGCTAGG - Intergenic
1115164440 14:30431625-30431647 CTCCCATTCCACTTGGGGATGGG + Intergenic
1116542348 14:46113416-46113438 CTCAGATGAGACATTGGGCTTGG + Intergenic
1117396015 14:55311509-55311531 CTCACATGACACTTTGGACTTGG - Intronic
1118318307 14:64738642-64738664 CTCCCACGCCCCAAGGGGCTGGG - Intronic
1119682699 14:76604806-76604828 CTCCCAGTTCAGATGGGGCTTGG + Intergenic
1121328411 14:93034891-93034913 CTCCCATCACCTATGGGGCCTGG + Intronic
1121731784 14:96192540-96192562 CTCATCTGACACCTGGGGCTGGG + Intergenic
1121941792 14:98077735-98077757 CTCACATGGCACAAGGGGCAAGG + Intergenic
1125579790 15:40776922-40776944 CACCCCTGACACATGGCCCTGGG - Intronic
1126040338 15:44584397-44584419 CTCACATGCCACATGGGCCTGGG + Exonic
1127310973 15:57752192-57752214 CTCCTATCATACCTGGGGCTGGG - Intronic
1132595402 16:746823-746845 CCCCCATCACACACAGGGCTAGG + Intronic
1134386770 16:13780860-13780882 CCCCCAGGACACATGGGGACTGG - Intergenic
1135973606 16:27090167-27090189 CTCCAATGACACCATGGGCTTGG - Intergenic
1135975057 16:27103269-27103291 CTCCCATGTCATATGGTTCTGGG - Intergenic
1136788153 16:32947554-32947576 CACACATGACACACGGGGCGTGG - Intergenic
1136881631 16:33906235-33906257 CACACATGACACACGGGGCGCGG + Intergenic
1137357524 16:47780903-47780925 TTCCCATGACAGAAGGGGCTAGG + Intergenic
1138381110 16:56603236-56603258 CTCCCCTGCCATATGGGGCAGGG - Intergenic
1138895624 16:61200339-61200361 CTCCCATGACATGTGGGAATTGG - Intergenic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1141563703 16:84887137-84887159 CCCCGATGACCCCTGGGGCTCGG + Intronic
1203090381 16_KI270728v1_random:1209211-1209233 CACACATGACACACGGGGCGCGG - Intergenic
1143994743 17:10996874-10996896 CTCACATGAGACATGGGTTTGGG + Intergenic
1144768683 17:17746928-17746950 CTCAGAAAACACATGGGGCTGGG - Intronic
1146377814 17:32306442-32306464 CTCCCATGACAGACTGGGATAGG - Intronic
1146946103 17:36874695-36874717 CTGCCATTACTCATGGGACTTGG + Intergenic
1152751205 17:82063203-82063225 CTCCCAGGACATCTGGGGCTGGG + Intronic
1158387546 18:57012421-57012443 CCTCCATGCCACATGGGGTTGGG + Intronic
1161550183 19:4908563-4908585 CTCCAAGGACAGATGGGTCTAGG - Intronic
1161689155 19:5720815-5720837 CTGCCAGGACTCCTGGGGCTGGG + Intronic
1161820609 19:6528830-6528852 CTCCCATCTCCCATGGGGCTGGG + Intergenic
1163064863 19:14785320-14785342 TTCCCATGACTCATGGGGAGAGG - Intergenic
1163795281 19:19334384-19334406 CTGCCAAGACACAGGGGGCCAGG - Intronic
1164580623 19:29432880-29432902 CTACCGTGGCACCTGGGGCTGGG - Intergenic
1164648163 19:29873831-29873853 CTCCCAGGAGACGTGGGGCTCGG - Intergenic
1164699301 19:30271789-30271811 CTCCTAGGACACATAGGGCAAGG - Intronic
1164865060 19:31597881-31597903 CTCCCATGTCACCAGGGGCGAGG + Intergenic
925437876 2:3856978-3857000 CTCAAAGCACACATGGGGCTTGG - Intergenic
925586957 2:5474485-5474507 CTCCCAGAAAACACGGGGCTCGG - Intergenic
926242833 2:11101363-11101385 CTGCCATAACACATGGAGCTGGG - Intergenic
928460533 2:31468194-31468216 CTCCCATTACACGTGGGAATTGG - Intergenic
929880867 2:45836567-45836589 CTCCCATGCCAGGTGGGTCTGGG + Intronic
931162373 2:59705780-59705802 CTCCCTTGACACCTGGGGACTGG + Intergenic
931949735 2:67349532-67349554 CTCAGATGACACTTTGGGCTTGG - Intergenic
936020869 2:108993928-108993950 CTCCCATGGCAGATGGGGTGAGG + Intergenic
937648478 2:124294025-124294047 ATCCCAGGATGCATGGGGCTGGG + Intronic
938694556 2:133823453-133823475 CTTCAGTGACACATGGAGCTGGG - Intergenic
938981716 2:136533304-136533326 CTCCCTTCACACATGTGGCCAGG - Intergenic
939008670 2:136819587-136819609 GTACCATGAAACATGGGACTTGG + Intronic
945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG + Intergenic
946607859 2:221425439-221425461 TTCCTATGACACAGGGGGCCTGG - Exonic
946638052 2:221752257-221752279 CTCCCGTGGCACCTGAGGCTGGG + Intergenic
947261336 2:228226420-228226442 CTCCAATGACAAATGGATCTAGG + Intergenic
947777839 2:232728589-232728611 CTCCCATGACCAATGTGGCATGG - Intronic
947794563 2:232885791-232885813 CTGCAGTGACACATGGGGCCCGG + Intronic
948127930 2:235578339-235578361 CTCCCAGGACACCTGGGGGCAGG - Intronic
949071977 2:242030896-242030918 CTGCCATGACACCTGCTGCTCGG + Intergenic
1169500281 20:6153214-6153236 CTCCCTTGACACATGGGAATTGG + Intergenic
1174078375 20:47953966-47953988 AGCACATGTCACATGGGGCTGGG + Intergenic
1174129447 20:48332128-48332150 CTCCCATGAAAGGTGGGTCTAGG - Intergenic
1175789432 20:61732197-61732219 CTCCCATGAAAGATGCTGCTGGG - Intronic
1175954102 20:62599513-62599535 CTCCCATGACAGAGGAGCCTGGG - Intergenic
1179156854 21:38858555-38858577 CTCCCTTGAAACCTGGGGGTGGG - Intergenic
1179494742 21:41764428-41764450 CACCCCTGACACACGGGTCTGGG - Intronic
1179766650 21:43578748-43578770 CTCCCAGGTTAGATGGGGCTAGG + Intronic
1180200890 21:46223418-46223440 ATTCCATGGCACATGTGGCTGGG - Intronic
1180957475 22:19747394-19747416 GTCCCCTGAAGCATGGGGCTGGG - Intergenic
1183571449 22:38656432-38656454 CTCCACTGACACATTGGTCTGGG - Intronic
1185336484 22:50272879-50272901 CACACATGAAACTTGGGGCTGGG - Intergenic
951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG + Intergenic
954290305 3:49646451-49646473 CACCTGTGATACATGGGGCTGGG + Intronic
954700614 3:52448939-52448961 CTCCCAAGACTGCTGGGGCTTGG + Intergenic
957908869 3:86595081-86595103 CTCCCATGACACATGCTCCTTGG + Intergenic
958016225 3:87942557-87942579 CTCCCTTGACATAAGGGGCTTGG + Intergenic
960325671 3:116292734-116292756 CTTCCATGGCAAATGAGGCTGGG - Intronic
962047419 3:131775485-131775507 CTCCCATAACACATGGGAATTGG - Intronic
962128966 3:132652116-132652138 CACCCATGATACATGGGAATTGG - Intronic
963616941 3:147551953-147551975 ATACCATCACACTTGGGGCTAGG + Intergenic
966626794 3:182025512-182025534 TTACCATGACACAGAGGGCTTGG + Intergenic
969738397 4:9006336-9006358 GTCCCAGGACAGATGGGTCTGGG + Intergenic
969981928 4:11166512-11166534 CTCCCATTAAAGATGGGGCAGGG - Intergenic
972485308 4:39534712-39534734 CTCCCATAACCCATGTGTCTTGG + Intergenic
972485311 4:39534715-39534737 CTCCCAAGACACATGGGTTATGG - Intergenic
972849404 4:43030412-43030434 CTCCCATGGCACACGGAGCATGG - Exonic
976804121 4:89026744-89026766 CTCCCTTGACACGTGGGGATTGG + Intronic
984808619 4:183774056-183774078 CTCCCAGAACACCTGGGACTGGG + Intergenic
985739949 5:1609438-1609460 CTGCCATGACACCTGCTGCTCGG - Intergenic
986000245 5:3625344-3625366 CTCCCATGACACATGGGAATTGG + Intergenic
987494778 5:18629846-18629868 CTCACATGACACTTTGGACTTGG - Intergenic
988133523 5:27137591-27137613 CTGCCATGAAAGAAGGGGCTAGG - Intergenic
989581170 5:43034446-43034468 CTCCAAAGACACATTGGACTCGG - Intergenic
991086607 5:62653517-62653539 GTCCCATGGCACTTGGGGTTAGG - Intergenic
994198542 5:96946045-96946067 CTGCCATGACACTTGAGTCTTGG + Intronic
994990601 5:106991764-106991786 CTGCCATAACACATTGGGCCAGG + Intergenic
995268597 5:110194731-110194753 CTCCCATGGCATGTGGGGCCTGG + Intergenic
997527061 5:134560278-134560300 CTAGGATGGCACATGGGGCTAGG + Intronic
998603401 5:143608075-143608097 CTCCCATGACACATGGAACTGGG - Intergenic
1001175769 5:169467726-169467748 CACCCATCACACTGGGGGCTTGG + Intergenic
1001649371 5:173304455-173304477 CTTCCATGACACGTGGGGTGCGG + Intergenic
1002654050 5:180728315-180728337 ATACCCTGAGACATGGGGCTAGG + Intergenic
1003572793 6:7267053-7267075 CTGCCATCACCCGTGGGGCTTGG - Intergenic
1003574980 6:7284486-7284508 ATCCCATGAAGCATGGGGCGGGG - Exonic
1004066221 6:12247160-12247182 CTGCCATGCCACAGGTGGCTGGG + Intergenic
1013605032 6:111739496-111739518 CTCTCATGAGACAGGCGGCTGGG - Intronic
1014132003 6:117845866-117845888 CTCCCTTGCCAGATGGGGCTGGG + Intergenic
1016343216 6:143084292-143084314 CTCCCTTGACATAAGGGGCATGG + Intronic
1017138261 6:151167166-151167188 CTCCCAGGACACATTTTGCTTGG - Intergenic
1017693903 6:156994933-156994955 CTCCCCTGTCAGCTGGGGCTGGG + Intronic
1018650775 6:165989477-165989499 CTCTCATGGCACAAGGGGTTGGG - Intergenic
1019414855 7:922477-922499 CTCCCATGGCATCTTGGGCTGGG - Intronic
1019531124 7:1504063-1504085 CTCCCTTGCCGCACGGGGCTTGG + Intronic
1020479525 7:8640835-8640857 TCCCAATGACTCATGGGGCTGGG + Intronic
1023225465 7:37964576-37964598 CCCCCTTGACACATGGGTATGGG + Intronic
1023937726 7:44751162-44751184 CTCCTATGTCACATGAGCCTGGG - Intronic
1025022517 7:55490583-55490605 CTCCCATGCCAAGTGGGGCAGGG + Intronic
1027181571 7:75944081-75944103 CTCCACTGACACATGGGGTGGGG - Intronic
1027586230 7:80062200-80062222 CCCACATGAAACATGGGGATGGG - Intergenic
1027733524 7:81904686-81904708 CTCCCATAACACATGGGTGGAGG + Intergenic
1029666146 7:101996477-101996499 CTCCATGGTCACATGGGGCTTGG - Intronic
1030007917 7:105136674-105136696 CGCACATAACACATGGAGCTAGG + Intronic
1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG + Intergenic
1031846720 7:126813847-126813869 CTCCCATAAAACATGAGCCTTGG - Intronic
1034313882 7:150112215-150112237 CCTCCTTGACTCATGGGGCTGGG + Intergenic
1034793015 7:153988577-153988599 CCTCCTTGACTCATGGGGCTGGG - Intronic
1035047516 7:155978478-155978500 CTCCCAGTGCACAGGGGGCTTGG - Intergenic
1035738188 8:1904597-1904619 CTCCGAATACACATGGGGCACGG + Intronic
1036527729 8:9550829-9550851 CTCCCATGACATGTGGGGACTGG + Intergenic
1039174884 8:34792630-34792652 CTGCCAGGACAAAGGGGGCTAGG - Intergenic
1040673242 8:49717616-49717638 CTCACATGGCAGATGGGGCAAGG - Intergenic
1042027584 8:64440358-64440380 CTCCCATGAAACGTGGGGTCTGG - Intergenic
1042655603 8:71092033-71092055 CTCCCCTGCCACATGAGGCACGG + Intergenic
1045183280 8:99809962-99809984 CTCCCATGACAGAGTGGGCCTGG + Intronic
1046430260 8:114115002-114115024 CTTACATGACAAAAGGGGCTTGG - Intergenic
1046772201 8:118127284-118127306 CTCCCATTACACACAAGGCTTGG + Intergenic
1049418538 8:142506430-142506452 CACCCTGGACACATGGGGGTGGG + Intronic
1051231113 9:14956716-14956738 ATACCATGACAAATGTGGCTGGG + Intergenic
1057892476 9:98879948-98879970 CTCCCCTGCCATAAGGGGCTCGG - Intergenic
1060303649 9:122391700-122391722 CTCCCATGACAAATGGTCCCCGG + Intronic
1060361892 9:122966995-122967017 CTCCCACAACACATGGGAATTGG + Intronic
1062045122 9:134421490-134421512 CTTGCATGGCACATGGGGCTTGG - Intronic
1062552450 9:137095821-137095843 TTCCGATGACATATGGAGCTGGG - Intronic
1062587584 9:137256207-137256229 CGCCCAGGACACATGGGTCAAGG - Intronic
1185785443 X:2887009-2887031 CTCCCCTCACACCTGGGGCCAGG + Intergenic
1187574611 X:20541293-20541315 TTCCCTTGACACATGGGATTAGG - Intergenic
1188949664 X:36354803-36354825 TTCTCATGACACATTGGTCTTGG + Intronic
1189668678 X:43384630-43384652 CTCACATGGCACAAGGGGCAAGG - Intergenic
1193467940 X:81869482-81869504 CCCCCATGACATAGGGGTCTGGG + Intergenic
1194941610 X:100016995-100017017 CTCACATGAGACATTGGACTTGG + Intergenic
1198036735 X:132808416-132808438 CTCCCATGACACATGGGGCTGGG - Intronic