ID: 1198039732

View in Genome Browser
Species Human (GRCh38)
Location X:132838246-132838268
Sequence ATGACTCTCTGGCAGTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198039732_1198039737 21 Left 1198039732 X:132838246-132838268 CCCTTTTACTGCCAGAGAGTCAT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1198039737 X:132838290-132838312 CACTCATCAGATGAGATCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 109
1198039732_1198039735 -10 Left 1198039732 X:132838246-132838268 CCCTTTTACTGCCAGAGAGTCAT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1198039735 X:132838259-132838281 AGAGAGTCATCAGTTCTGTCCGG 0: 1
1: 0
2: 1
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198039732 Original CRISPR ATGACTCTCTGGCAGTAAAA GGG (reversed) Intronic
903669601 1:25027703-25027725 AAGAGTGTCTGGCAGAAAAACGG - Intergenic
903804946 1:25998599-25998621 AAGACTCCCTGGCAGAGAAAGGG + Intergenic
903906080 1:26687906-26687928 ATCACTCACAGGCAGTCAAAAGG + Intergenic
904046641 1:27613130-27613152 ATGGGTCTCTGTCAGTCAAAGGG + Intronic
906007303 1:42486818-42486840 AATACTATCTGCCAGTAAAAAGG + Intronic
908036411 1:60059122-60059144 ATGACTCTCTAGCTGAGAAACGG + Intronic
909328927 1:74389086-74389108 AAGACTCTCTGGCAGTGTTATGG + Intronic
909988524 1:82192394-82192416 ATGATTGTCTGGCAGCACAAAGG - Intergenic
911431676 1:97796899-97796921 AGGAATGTTTGGCAGTAAAATGG + Intronic
911630409 1:100177079-100177101 ATAACTCTATGGCAGTGTAAGGG + Intronic
915067800 1:153241076-153241098 ATCACAGTCTGACAGTAAAAAGG + Intergenic
918909046 1:190541512-190541534 ATAAGTCTGTTGCAGTAAAATGG + Intergenic
920755383 1:208725710-208725732 ACAACTCTGTTGCAGTAAAATGG - Intergenic
921060898 1:211583684-211583706 AGATCACTCTGGCAGTAAAATGG - Intergenic
1063005712 10:1968718-1968740 ATGGCTCTCAGGAAGTAGAAAGG - Intergenic
1064947023 10:20801933-20801955 AAGACTCTCTCACAGCAAAATGG + Intronic
1068446013 10:57124678-57124700 ATCAGTCTCTGCTAGTAAAAGGG + Intergenic
1071768029 10:88690815-88690837 AAGAGTCACTGGCCGTAAAAAGG + Intergenic
1073047227 10:100646734-100646756 ATGAGTCTCTGGAAGTAATTGGG - Intergenic
1075888234 10:125921361-125921383 ATTACTATTTGGCAATAAAAAGG - Intronic
1076207964 10:128618316-128618338 AGGACACTGTGGCTGTAAAATGG + Intergenic
1076444806 10:130507179-130507201 ACGCCACTCTGGCAGGAAAAGGG + Intergenic
1077775529 11:5267610-5267632 CTGGCTCTCTGGAAGTAGAAGGG - Intronic
1077879185 11:6334767-6334789 ATGACTATGTAGCAGAAAAATGG + Intergenic
1078151217 11:8761076-8761098 AGGACCATCTGGCAGGAAAAGGG - Intronic
1078505013 11:11931762-11931784 ATGATTATTTGGCATTAAAAAGG - Intronic
1078828333 11:14953222-14953244 ATGACTCTCTGGAAAGAAAAGGG + Intronic
1079123056 11:17698764-17698786 ATGAATTTATGGCAATAAAATGG - Intergenic
1079561280 11:21823186-21823208 ATGACTTTCGAGAAGTAAAAGGG + Intergenic
1080480785 11:32647690-32647712 CTAACTCTCTGGCAGAAAAATGG - Intronic
1081402346 11:42657892-42657914 ATGAAGCTGTGGCAGTGAAATGG - Intergenic
1085367823 11:75968213-75968235 ATGAGTCTCTGCCAAAAAAATGG - Intronic
1085590964 11:77760233-77760255 ATGAGTATTTGGCAATAAAAAGG + Intronic
1086836910 11:91636716-91636738 TTGGCTCTGTGGCACTAAAATGG + Intergenic
1089039583 11:115434070-115434092 ATGACACTCTGGCCGTCAAGTGG + Intronic
1093118395 12:15238624-15238646 ATTACTCTCTGGGAGAAAAAAGG + Intronic
1095575462 12:43732938-43732960 ATGACTCTGTGAAAGAAAAAAGG - Intronic
1098056418 12:66510876-66510898 ATGTCTCACTGGCAATGAAAAGG + Intronic
1100113675 12:91276526-91276548 ATGACTCTCATGGAGTAAAAGGG - Intergenic
1100353785 12:93809657-93809679 GTGACTCTGAGGCAGTAAAGAGG - Intronic
1101671919 12:106883604-106883626 ATGACTCACTGGGAGGAAAAGGG - Intronic
1101693783 12:107105789-107105811 ATGACTCCCAGGAAGTAAAAGGG - Intergenic
1104475710 12:129068871-129068893 ATGATGCTCTGGCAGGAAGACGG - Intergenic
1105220311 13:18320013-18320035 ATTACTATTTGGCAATAAAAAGG + Intergenic
1106800541 13:33252091-33252113 ATGGCCCTCTGGCACTAAAAAGG + Intronic
1108228005 13:48309380-48309402 TAAAATCTCTGGCAGTAAAAAGG + Intronic
1110673982 13:78217286-78217308 ATGCCTCTTTTGCAGTAAACTGG + Intergenic
1112846425 13:103648629-103648651 ATCCCTGTCTGGCAGTAACAAGG - Intergenic
1115176288 14:30564803-30564825 ATGATTATGTGGCAATAAAAAGG - Intronic
1115566337 14:34628755-34628777 ATGTCTCTCTCACATTAAAACGG + Intronic
1116379503 14:44247797-44247819 ATGAATCTATGGCAATTAAACGG - Intergenic
1116546539 14:46173473-46173495 ATCTCTCTCTTGCAGTGAAAAGG + Intergenic
1118813451 14:69292031-69292053 AAGAATCTCTGGCAGGAAAGGGG + Intronic
1119082890 14:71712935-71712957 CTGACTAGATGGCAGTAAAAAGG - Intronic
1124322807 15:28727409-28727431 GGGACTCTGTGGCAGGAAAAGGG + Intronic
1124523726 15:30427974-30427996 GGGACTCTGTGGCAGGAAAAGGG + Intergenic
1124534941 15:30538241-30538263 GGGACTCTGTGGCAGGAAAAGGG - Intergenic
1124574379 15:30895395-30895417 GGGACTCTGTGGCAGGAAAAGGG - Intergenic
1124763708 15:32469360-32469382 GGGACTCTGTGGCAGGAAAAGGG + Intergenic
1124774919 15:32579691-32579713 GGGACTCTGTGGCAGGAAAAGGG - Intergenic
1126882222 15:53111339-53111361 ATTACTCTCTGGCACATAAAGGG + Intergenic
1127978922 15:64019930-64019952 TTGACTCTGTGGCATGAAAATGG - Intronic
1128346792 15:66858775-66858797 AGGACTCTGTGGCTGTAAAGGGG - Intergenic
1138578697 16:57925608-57925630 GTGACTCTGTGAAAGTAAAATGG + Intronic
1139136296 16:64208380-64208402 ATTCTTCTCTGGCAGGAAAATGG + Intergenic
1141332578 16:83125449-83125471 CTGATTCTCTGGAATTAAAATGG - Exonic
1143326462 17:6101619-6101641 CTGACTCTCTGCCAGCAAGAGGG + Intronic
1146085673 17:29826706-29826728 AGGTCTCTCTGGAGGTAAAAAGG - Intronic
1148624050 17:49055357-49055379 AGGACTCACTGGCAGGAATAGGG - Exonic
1151090128 17:71429535-71429557 ATGATTGTCTTGCAGTAAAGTGG + Intergenic
1155373744 18:25133987-25134009 ATTACTCTGTGGCACAAAAATGG - Intronic
1157740043 18:50084374-50084396 CTGAATCTCTGGCACAAAAATGG + Intronic
1162265189 19:9567476-9567498 ATCAGTCTCTGGTAGCAAAAAGG - Intronic
1163978719 19:20877901-20877923 GTGACTGGCTGACAGTAAAATGG - Intergenic
1168660710 19:58163763-58163785 ATGAGTCAATGGAAGTAAAAAGG + Intergenic
927670366 2:25063760-25063782 ATGACAGTGTGGCAGTAACAGGG + Intronic
928419487 2:31126861-31126883 ATGTCTCTCTGTCTATAAAAGGG + Intronic
929218472 2:39439346-39439368 TTGGCTTTCTGGCACTAAAAAGG - Intergenic
933058086 2:77699024-77699046 ATGACTCTCAGGCAGTGGAAAGG + Intergenic
934972130 2:98772319-98772341 CTGACTCTCTGGGAATAAAAAGG + Intergenic
936431256 2:112465566-112465588 AGGAGTCACTGGCAGTAAATTGG - Intergenic
936740870 2:115506776-115506798 CTGATTATCTGGTAGTAAAATGG - Intronic
939010371 2:136839234-136839256 GTGACCCTCAGGCAGTAGAAAGG - Intronic
942620625 2:177841754-177841776 ATGGCTCTCTGGCTGAAAAATGG + Intronic
942705778 2:178770220-178770242 ATGACACTGTTCCAGTAAAATGG - Exonic
943672211 2:190675078-190675100 ATGACTCACTGCCACTGAAAGGG + Intronic
943806021 2:192127205-192127227 ATGATTCTCTGTCAGCAAGAAGG + Intronic
945039319 2:205730864-205730886 CTCACCCACTGGCAGTAAAAAGG - Intronic
945557963 2:211302424-211302446 ATGACTAGCTGGAATTAAAAGGG - Intergenic
945818892 2:214638789-214638811 ATGTCTCTGAGGCTGTAAAATGG - Intergenic
1178316813 21:31573739-31573761 ATTCCTCTCTCTCAGTAAAAAGG - Intergenic
1183855568 22:40631429-40631451 GTGACTCACTAGCTGTAAAATGG - Intronic
1185103481 22:48854199-48854221 ATGATTCTGTTGGAGTAAAAAGG - Intergenic
950497715 3:13344012-13344034 AAGGGTCTCTGGCAGTGAAAAGG - Intronic
950579909 3:13855310-13855332 CAGTCTCTCTGGCTGTAAAATGG + Intronic
950604445 3:14065310-14065332 ATGACTGTCTGGCAAGAAATTGG - Exonic
955572154 3:60319503-60319525 ATAACTGACTGCCAGTAAAAGGG + Intronic
955595853 3:60589619-60589641 ATAACTCTGTGGAAGCAAAATGG + Intronic
956127695 3:66026852-66026874 ATGTCTCTCTGGCAGCAAAAGGG + Intronic
957237518 3:77613425-77613447 ATTACTTTTTGGCAGAAAAAAGG + Intronic
957870035 3:86079922-86079944 ATCACTCTCTGGCTGGAAAGAGG + Intergenic
962589780 3:136877970-136877992 AATACTATTTGGCAGTAAAAAGG + Intronic
963215816 3:142746061-142746083 TTGCCTCTCTAGAAGTAAAAGGG - Intronic
963806011 3:149723724-149723746 ATGACTCTCAGGGAATATAAAGG - Intronic
964913673 3:161813110-161813132 TTAACTCTCAGGCAGTGAAAAGG - Intergenic
966620634 3:181959817-181959839 ATTTCTCTCAGGCAGTAAAAAGG + Intergenic
971671259 4:29560926-29560948 ATAACTATCTTACAGTAAAAAGG - Intergenic
972836200 4:42872780-42872802 ATCAATCTGTGGCATTAAAAGGG + Intergenic
977282089 4:95052980-95053002 ATGACTCTCAGGCAATGAAGAGG - Intronic
978362026 4:107940649-107940671 TTGGCTCTCTGGCTGTACAAAGG + Intronic
979555737 4:122044947-122044969 ATGACTCTCCAGCAATGAAAGGG + Intergenic
982997914 4:162374715-162374737 ATCTCTCTCTGGAAGTAAAACGG + Intergenic
985110918 4:186545858-186545880 AATATTCTCTGGCAGTACAAGGG + Intronic
986511882 5:8516528-8516550 ATTAATCTATGGCAGAAAAAAGG - Intergenic
986643454 5:9893792-9893814 AAGACTCTGTGGGAGGAAAAAGG + Intergenic
987452218 5:18099995-18100017 ATGATTCTGTGGCATGAAAAGGG - Intergenic
988446611 5:31293111-31293133 ATGACTAACTGTCAGTGAAATGG - Intronic
992683048 5:79172090-79172112 TTGACTCTGTGGCTGTAACAGGG + Intronic
992787196 5:80181773-80181795 AGGACTCTGTGGCCATAAAAAGG + Intronic
993771662 5:91935746-91935768 AAGACCCTCTGCCAGCAAAAAGG - Intergenic
995746509 5:115409420-115409442 AAGACTCTCTGGGAGGGAAATGG + Intergenic
995858576 5:116618709-116618731 TGGACTTTCTGGCAATAAAATGG - Intergenic
999539820 5:152559136-152559158 ATGGCCCTCAGGCAATAAAATGG - Intergenic
1003031094 6:2601257-2601279 ATAACTCTGTGGTAATAAAATGG + Intergenic
1003338710 6:5199206-5199228 AAGACTATTTGGCATTAAAAAGG + Intronic
1004419956 6:15460358-15460380 AGTACTCACTGGCAGCAAAAAGG - Intronic
1004686714 6:17953352-17953374 ATTACTCTTAGACAGTAAAAGGG + Intronic
1008505796 6:52228463-52228485 AAGTCTCTCTGGCCGTATAAGGG + Intergenic
1009416416 6:63420600-63420622 CAGACTACCTGGCAGTAAAAAGG + Intergenic
1011396993 6:86920478-86920500 GTGAGTCTCTGGAAGGAAAATGG - Intergenic
1011627924 6:89298500-89298522 ATCATTCTGGGGCAGTAAAAAGG - Intronic
1014699468 6:124665777-124665799 ATGACTCTCAGGGCCTAAAAAGG - Intronic
1020606735 7:10347473-10347495 ATAACTTTCTTGCAGTAATATGG - Intergenic
1020671288 7:11116521-11116543 ATAACTCTCTGACAGAAAACTGG + Intronic
1022624736 7:32023582-32023604 ATGACTATTTAGCATTAAAAAGG + Intronic
1022965369 7:35466964-35466986 CTGCCTCTATGGCAGAAAAAAGG - Intergenic
1023054208 7:36278685-36278707 ATGATTCCCTGGCAGGAAATGGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1030657661 7:112185706-112185728 ATGGATCTGTGGCAGTACAAGGG - Intronic
1032623036 7:133557395-133557417 TTGATTCTCTGCCAGTTAAATGG + Intronic
1035623438 8:1052366-1052388 CTGACTCAAAGGCAGTAAAAAGG + Intergenic
1036179369 8:6569839-6569861 AAGAGTCTCTGGCAGTGAAATGG - Intronic
1036719866 8:11164133-11164155 CTGACTTTCTGGCAGTGAATAGG - Intronic
1038382851 8:27113078-27113100 ATGCCACTCAGGCAGGAAAAAGG + Intergenic
1039724277 8:40198510-40198532 AGGAATCTCTGATAGTAAAATGG - Intergenic
1040017984 8:42715799-42715821 ATTACTGTCTGGAAGTACAAAGG - Intronic
1040871670 8:52106084-52106106 ATGAATCTCTGGCGATGAAAAGG + Intergenic
1043476897 8:80614015-80614037 ATGTCTCACTGGAAATAAAATGG - Intergenic
1043886754 8:85609798-85609820 ATGTCTCTTTGGCATTGAAAAGG - Intergenic
1045012603 8:97971145-97971167 AGGACTCTCTGACAGTATCAAGG - Intronic
1047564070 8:126022325-126022347 AAGACTTTCTGGTAGCAAAAAGG + Intergenic
1048709229 8:137189248-137189270 ATGACTCTCAGGAAGTACATTGG - Intergenic
1050073770 9:1842953-1842975 TTGACTCTCTGGCCCTAACATGG + Intergenic
1054906103 9:70414796-70414818 AAGAATCTCAGGCAGTAAAAAGG - Intergenic
1056483870 9:87034669-87034691 ATAGCTCTGTGGCAGGAAAAAGG + Intergenic
1058583993 9:106487094-106487116 ATGACTCTCTGGGAATACCATGG + Intergenic
1061566138 9:131441715-131441737 ATGACTCTTTGGAATTCAAAAGG + Intronic
1186549481 X:10487845-10487867 AATACTCTTTGGCAATAAAAAGG - Intronic
1187856712 X:23644017-23644039 ATGATCCTCTGGGAATAAAAAGG + Intergenic
1192550520 X:72049667-72049689 TTGAGACACTGGCAGTAAAAGGG - Intergenic
1194997360 X:100605699-100605721 ATGGCTCTTTGGCAGGAATAGGG + Intergenic
1198039732 X:132838246-132838268 ATGACTCTCTGGCAGTAAAAGGG - Intronic
1198465213 X:136898740-136898762 AATACTATTTGGCAGTAAAAAGG - Intergenic
1201799561 Y:17940395-17940417 ATGTTTTTCTGGCAGCAAAAAGG - Intergenic
1201801992 Y:17965561-17965583 ATGTTTTTCTGGCAGCAAAAAGG + Intergenic
1202626494 Y:56864706-56864728 ATTACTATTTGGCAATAAAAAGG + Intergenic