ID: 1198041321

View in Genome Browser
Species Human (GRCh38)
Location X:132855662-132855684
Sequence TTTACAAATTTCTAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198041321_1198041327 21 Left 1198041321 X:132855662-132855684 CCCACCAACTAGAAATTTGTAAA 0: 1
1: 0
2: 0
3: 24
4: 285
Right 1198041327 X:132855706-132855728 CTCTACTCCCTACATTGGCATGG 0: 1
1: 0
2: 0
3: 3
4: 93
1198041321_1198041325 16 Left 1198041321 X:132855662-132855684 CCCACCAACTAGAAATTTGTAAA 0: 1
1: 0
2: 0
3: 24
4: 285
Right 1198041325 X:132855701-132855723 TAATCCTCTACTCCCTACATTGG 0: 1
1: 0
2: 0
3: 7
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198041321 Original CRISPR TTTACAAATTTCTAGTTGGT GGG (reversed) Intronic
906434568 1:45784327-45784349 TTTACAAACTAATAGTTGGCCGG - Intergenic
907630112 1:56072523-56072545 CTTATCAATTTATAGTTGGTGGG - Intergenic
909323608 1:74321290-74321312 CTTACAAATATCTCTTTGGTGGG + Intronic
909448112 1:75770057-75770079 TTTAAAAAATTTTAATTGGTCGG - Intronic
909502278 1:76348067-76348089 TTTCAGAACTTCTAGTTGGTAGG - Intronic
909730915 1:78888307-78888329 TTTACTAATTTGAAGTTGCTGGG + Intergenic
909958950 1:81813204-81813226 TTTAGAATTTGCTTGTTGGTTGG + Intronic
910937432 1:92496263-92496285 TTTGCAAATTTACATTTGGTAGG - Intergenic
911435355 1:97849288-97849310 TTGACTTATTTCTAGGTGGTAGG + Intronic
911607572 1:99925883-99925905 TTTAAAAATTTTTAGCTTGTTGG + Intergenic
913090727 1:115475002-115475024 TTTAGAAATTTCCACTTGCTGGG + Intergenic
913597352 1:120391417-120391439 TTTCCAAATTTTTATTTTGTTGG - Intergenic
914089976 1:144487893-144487915 TTTCCAAATTTTTATTTTGTTGG + Intergenic
914308632 1:146446320-146446342 TTTCCAAATTTTTATTTTGTTGG - Intergenic
914593478 1:149126811-149126833 TTTCCAAATTTTTATTTTGTTGG + Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916713162 1:167430017-167430039 TTTACACAATATTAGTTGGTGGG + Intergenic
917644691 1:177018477-177018499 TTTACACATTTCCACATGGTTGG + Intronic
917895250 1:179480866-179480888 TTCACTAATTTCTAGTTGATTGG + Intronic
918547650 1:185703440-185703462 TTTACCAATGACTAGTTGTTTGG - Intergenic
918891645 1:190279872-190279894 TTTACATATATCTAGTTATTTGG + Intronic
919201859 1:194365305-194365327 TTTAAAAATATCTATTTGGGTGG + Intergenic
920619944 1:207535226-207535248 TTTACAACTTTCTAGCTGTTTGG - Intronic
920621725 1:207553781-207553803 TTTACAACTTTCTAGCTGTTTGG - Intronic
920623351 1:207570876-207570898 TTTACAACTTTCTAGCTGTTTGG - Intronic
921014310 1:211173858-211173880 TTTCCAAATGTACAGTTGGTTGG - Intergenic
921641195 1:217557108-217557130 TTTAAAAATGTCAAGTTGGCCGG + Intronic
923228395 1:231960865-231960887 AATCCCAATTTCTAGTTGGTTGG - Intronic
924578961 1:245306655-245306677 TTTACAAATGTATAGATGGTGGG - Intronic
1063743840 10:8857146-8857168 TTTTCAGATTTCTAGATGGGAGG + Intergenic
1063806585 10:9651478-9651500 TTTACAAATTTCTGGCTGCCTGG - Intergenic
1064678150 10:17782322-17782344 GTAACAAATTTCTAGTTTGTAGG - Intronic
1064711107 10:18126047-18126069 TTTACATATTTCTAGGTTATAGG + Intergenic
1065039861 10:21681366-21681388 TTGACAACTTACTAGTTGTTGGG - Exonic
1065422248 10:25558242-25558264 TTTATAAGTTTAAAGTTGGTTGG - Intronic
1068114327 10:52720137-52720159 TTTACAAATTTTAATTTGGCTGG - Intergenic
1068480401 10:57581762-57581784 TTTAAAAATTTGTATTTGTTTGG + Intergenic
1068984283 10:63092683-63092705 TTTAAAAATTTTTTGTTGGCGGG - Intergenic
1069012302 10:63387330-63387352 TTTATAAATTTCTTTTTGATTGG - Intronic
1070208500 10:74289119-74289141 TTTAAAAATTTCTTTCTGGTGGG - Intronic
1074657409 10:115608949-115608971 TTTTTAAATTTCCAGTTGTTTGG + Intronic
1075235410 10:120723187-120723209 TTTACTAATTTCCAGTGGGGCGG - Intergenic
1075692006 10:124403136-124403158 ATTACACATTTATTGTTGGTGGG - Intronic
1077090069 11:774317-774339 TATAAAAATTTTTGGTTGGTGGG - Intronic
1078500573 11:11871198-11871220 TTTTAAAAATTCTGGTTGGTGGG + Intronic
1079534407 11:21494116-21494138 TTTAATAATTTTTAGTAGGTAGG + Intronic
1079809130 11:24973070-24973092 TTTTTAAATTTTTGGTTGGTAGG + Intronic
1080022901 11:27582061-27582083 TTTCCAAATGTACAGTTGGTTGG - Intergenic
1080845556 11:36023831-36023853 TTTACAGCTTTATAGTTGTTTGG + Intronic
1086871493 11:92042747-92042769 TATACAAATTTCTTTTTGTTTGG - Intergenic
1086892527 11:92274336-92274358 TTTAAAAATTTCTAGTAACTTGG + Intergenic
1087827146 11:102778403-102778425 TTTACAATATTGTACTTGGTGGG + Intronic
1088563314 11:111138229-111138251 TTTATAACTTTCTAGCTGGATGG + Intergenic
1090590980 11:128267786-128267808 TATACAAGTTTCTATGTGGTGGG + Intergenic
1092625924 12:10328701-10328723 TTTCTACATTTCTAGTTGCTTGG + Intergenic
1092810565 12:12267678-12267700 TTTAGAAATCTTTAGCTGGTCGG - Intergenic
1093400930 12:18745826-18745848 TTTACAAATATCTACTAAGTAGG + Intergenic
1094210865 12:27889302-27889324 TTTCTACATTTCTAGTTGATTGG + Intergenic
1096874634 12:54617725-54617747 TTTAAAAAATTCTGGTTGGGGGG + Intergenic
1098608316 12:72421911-72421933 TTTACACATTTCTATTTAATAGG - Intronic
1100970074 12:100060063-100060085 TTTAAAAATTTTTAATTGGATGG + Intronic
1101262882 12:103050772-103050794 TTTATAAATTTTTAATTGTTTGG - Intergenic
1102620080 12:114187385-114187407 TTTAAAAATTTCCAGTTGTTAGG + Intergenic
1103120229 12:118373603-118373625 TTTAGAAATTTTCAGTTTGTAGG + Intergenic
1104210310 12:126682817-126682839 TTTAGAAATGTTTAATTGGTAGG - Intergenic
1105468616 13:20671072-20671094 TTTCCACATTTCTAGTATGTGGG + Intronic
1106931978 13:34676137-34676159 TTTACTAATTACTAGTTTATCGG - Intergenic
1107050560 13:36043900-36043922 TTTACTACTTTCTAGTTTTTGGG - Intronic
1107160204 13:37216420-37216442 TTTTCAAATTGCAAGTTGCTGGG + Intergenic
1107297291 13:38923374-38923396 TTTATAAATTTCTAGAAGGAAGG - Intergenic
1107415281 13:40194231-40194253 TTTCAAGATTTCTAGTTGTTAGG + Intergenic
1107416347 13:40204566-40204588 TTTCCAAATTTCTGGGTTGTAGG - Intergenic
1107617464 13:42185100-42185122 TTTGCACGTTTCTGGTTGGTAGG + Intronic
1108043727 13:46363282-46363304 TTTCCCAATTTCTATTTAGTTGG - Intronic
1108340187 13:49491710-49491732 TTTTCAAATTTCTACTTTCTAGG + Exonic
1108819505 13:54330282-54330304 AGTACAAAATTCTAGTTGGTGGG - Intergenic
1110374417 13:74776194-74776216 TTTAGGAATTTCTAGTTGATAGG - Intergenic
1111659813 13:91194807-91194829 TTTACAAATTACTGGTTATTTGG - Intergenic
1111776931 13:92675722-92675744 TTTACAATTTTCTAGTTTCCTGG - Intronic
1113920680 13:113907325-113907347 TTTACAAATGTGTACATGGTGGG + Intergenic
1115126783 14:30004872-30004894 TTTACAGATTCATAGATGGTGGG - Intronic
1115647312 14:35378044-35378066 TTTAAAAACATTTAGTTGGTCGG + Intergenic
1116406204 14:44568814-44568836 TTTAGAGATTTCTTCTTGGTGGG - Intergenic
1117058975 14:51941820-51941842 TTTTCATGTTTCTTGTTGGTTGG + Intronic
1117407865 14:55421944-55421966 TTTATAAAATTCTAGTTTGGAGG + Intronic
1117625665 14:57635082-57635104 CTTACCAATTTCTTTTTGGTAGG - Intronic
1118947687 14:70402924-70402946 TGTAAAAATTTCTAGCTGCTTGG - Intronic
1119573692 14:75699055-75699077 CTTACAAATTTCTAAGTGTTGGG - Intronic
1119659248 14:76438756-76438778 TTTGCAAATTTCTAGTTTGAGGG - Intronic
1120144301 14:80962678-80962700 TATAAATATGTCTAGTTGGTGGG - Intronic
1121849329 14:97205578-97205600 TTTAAAAAATTCTTGCTGGTGGG + Intergenic
1122005221 14:98697864-98697886 ATTACATATTTCTATGTGGTAGG - Intergenic
1125239026 15:37551197-37551219 TTTAAAAATTTCAATTTGTTAGG + Intergenic
1125352277 15:38780566-38780588 TAAACAAATTTCTAGGTGCTAGG - Intergenic
1125549573 15:40535456-40535478 TTTACAAATTTATATTTTGAAGG + Intronic
1126993281 15:54408701-54408723 TTTACAAATTTTCAGTAGTTTGG + Intronic
1127181819 15:56428294-56428316 TTTACAAACTTCCTGTTGTTTGG + Intronic
1127567632 15:60208125-60208147 TTTCCTAATTTCTACTTGCTTGG - Intergenic
1128250490 15:66160488-66160510 TTTAAAATACTCTAGTTGGTGGG + Intronic
1128621193 15:69151306-69151328 TTTGCAAATATCTAGATGGAGGG + Intergenic
1130682067 15:86005663-86005685 TTTCAAAAAGTCTAGTTGGTAGG + Intergenic
1131592568 15:93765806-93765828 CTTATAAATTTCTATGTGGTGGG + Intergenic
1133607326 16:7400579-7400601 TTTCCAAATTTCTTCTTGCTGGG - Intronic
1135357056 16:21778010-21778032 TTTGCAGATTTATATTTGGTTGG + Intergenic
1135455560 16:22594124-22594146 TTTGCAGATTTATATTTGGTTGG + Intergenic
1137373115 16:47927229-47927251 TTTTTAAATTGCTAGTTGGCCGG - Intergenic
1137620704 16:49874892-49874914 TTTACAAATTTTTAATGGTTGGG - Intergenic
1138738762 16:59281877-59281899 TTTATAAATTTCTTTTTGATTGG - Intergenic
1140913568 16:79474920-79474942 TGCACACATTTCTAGTTGCTAGG - Intergenic
1141725458 16:85785271-85785293 TCTAAAAATTTGTAGTTGGCCGG + Intronic
1143241887 17:5450600-5450622 GTTCCAAATTTCTTGTGGGTAGG + Intronic
1148246698 17:46036218-46036240 TTTAGAAGTGTCTGGTTGGTTGG + Intronic
1149182154 17:53951785-53951807 TTTATAAATTTCTTTTTCGTTGG - Intergenic
1153306271 18:3634217-3634239 TATACAAATTTATAGTGGGGGGG - Intronic
1155188374 18:23407701-23407723 TTTAAAAATTGCTAGTTTCTTGG - Intronic
1155637112 18:27969161-27969183 TTAGCAAATTTTTTGTTGGTGGG - Intronic
1155679384 18:28471356-28471378 TTTTCAAATTTTTTATTGGTAGG - Intergenic
1156963023 18:43055945-43055967 TTTACAAAATTCTAATTTTTAGG - Intronic
1157428938 18:47607421-47607443 TAAACAAGTTTCTAGTTAGTGGG + Intergenic
1158791499 18:60785142-60785164 TTTACAGACTTCTAGGTGGATGG + Intergenic
1159419510 18:68198860-68198882 TTTACAAACATGTAGTTGCTCGG - Intergenic
1165665565 19:37624495-37624517 TTTATAAATTTCTTTTTGATTGG - Intronic
1165972063 19:39640041-39640063 TGTGGAAATTTCTAGTTGGCAGG + Intergenic
925674408 2:6345165-6345187 TTCACAAAATTCTAGTAAGTGGG - Intergenic
925758863 2:7164539-7164561 TTTACATATTGTTAGTTGGGAGG - Intergenic
926354607 2:12029778-12029800 TTTATAAATGTCTTATTGGTGGG - Intergenic
926427542 2:12753048-12753070 TTTGCAAATGTCTATTAGGTTGG + Intergenic
926656933 2:15417949-15417971 TCTACAAATTTATAATAGGTTGG - Intronic
930473445 2:51849647-51849669 TATACAACTTTCAATTTGGTGGG + Intergenic
934093492 2:88576213-88576235 TTAAAAAATTACTAGTTGATAGG - Intronic
934770113 2:96902397-96902419 TTTAAAAAATTGTAGTTGCTGGG - Intronic
935344249 2:102090316-102090338 TTAGCAAATTCCAAGTTGGTGGG - Intronic
936266390 2:111012161-111012183 TTTACAAATTAAAAGTTAGTGGG + Intronic
937625776 2:124042155-124042177 TTTAAAAATTTTTAATTGGCTGG - Intronic
939651413 2:144767154-144767176 AGTACCATTTTCTAGTTGGTGGG - Intergenic
941335586 2:164240264-164240286 TTTACAGATTTATAGGTGGAAGG - Intergenic
942383042 2:175412738-175412760 TTTGCCAATTTCTTGTTGGGTGG + Intergenic
942794525 2:179801651-179801673 TTTACAAATTTTTATATGGCAGG - Intronic
943140230 2:183973338-183973360 TTTACAAATTTCTTGGGGGCTGG - Intergenic
945673433 2:212829630-212829652 TTTACATATTTCTAATTAGTGGG - Intergenic
945971103 2:216233139-216233161 TTCACAAATTTCTTTTTGATTGG + Intergenic
946743122 2:222819263-222819285 TTTACAAATTTCTATCTACTGGG - Intergenic
949080643 2:242096155-242096177 TTTTAAAATTTAAAGTTGGTTGG + Intergenic
1170753647 20:19176379-19176401 TTTAAAAATTTCTTAGTGGTTGG - Intergenic
1171100081 20:22374709-22374731 TTCACAAATTTGTTGTTGTTGGG - Intergenic
1173412544 20:42826870-42826892 TTTTCTAATTTCTATTTGCTTGG - Intronic
1174234525 20:49078212-49078234 TTTACATTATTCTAGTGGGTAGG - Intronic
1174960188 20:55147594-55147616 TTTATTTATTTATAGTTGGTTGG - Intergenic
1175610213 20:60344974-60344996 TTTAGAAAGTTCTTGTTGTTGGG - Intergenic
1177215482 21:18122941-18122963 TTTACACAATTCTATTTGGATGG + Intronic
1177754748 21:25332843-25332865 TTTATAAATTTGTTTTTGGTTGG - Intergenic
1179102879 21:38370638-38370660 TATAAAGATTTCTAGTTGTTTGG + Intergenic
1181163385 22:20970755-20970777 TTTAAAAATTGCCAGTTGGCCGG - Intronic
1182055390 22:27349514-27349536 ACCACAAATTTCTAGTGGGTGGG + Intergenic
1184219800 22:43092540-43092562 TTTGCAAATGTACAGTTGGTTGG - Intergenic
1184243521 22:43223759-43223781 TTTACAGATGGCTAATTGGTCGG + Intronic
949860982 3:8504504-8504526 TTTATGACTTTCCAGTTGGTGGG - Intronic
949995116 3:9610516-9610538 ATTTTAAATTTCTAGTTGTTGGG + Intergenic
950343221 3:12267067-12267089 TTTCCAAATATCTTTTTGGTTGG + Intergenic
950934002 3:16820435-16820457 TTGACAATTTTCCAGATGGTGGG - Intronic
951240340 3:20279095-20279117 TTTACAAATTTCTTTATGATGGG + Intergenic
952100265 3:30003119-30003141 TTTACAAACTTCTAATCTGTGGG + Intronic
954896613 3:53980399-53980421 TTTACAAATTACCATTTGTTTGG - Intergenic
955009361 3:54999058-54999080 TTAACTAATTTCCAGTTGGAGGG + Intronic
957752711 3:84442952-84442974 TTTACAAAGTTCTTATTGATTGG + Intergenic
958859669 3:99431370-99431392 TATTCAAATTTCTATTTTGTAGG + Intergenic
959281928 3:104353250-104353272 TCTACAACTTTTCAGTTGGTTGG - Intergenic
959308735 3:104702768-104702790 TTTACAAGTTGCTTGTTGATCGG + Intergenic
960007946 3:112800352-112800374 TATCCAAATTTCAAGATGGTAGG + Intronic
960758148 3:121042101-121042123 ATTACAAAATTTAAGTTGGTGGG - Intronic
962690653 3:137894740-137894762 TTCACAAATTTTAAGGTGGTTGG + Intergenic
962748104 3:138412507-138412529 CTTACAAGTTTCCAGTTGATGGG + Intergenic
963413776 3:144967611-144967633 TTTACTAATTTCTAAATGCTTGG + Intergenic
963573770 3:147032885-147032907 TTTACAAATTTTCTGTTAGTAGG - Intergenic
965058987 3:163759395-163759417 TTTAAAAATTTATATTTAGTTGG + Intergenic
965564846 3:170104218-170104240 TTTTGAAATTTTTAGTTTGTTGG - Intronic
965918117 3:173876127-173876149 TTTAAAAATGTCAAGTTGGTAGG + Intronic
966282424 3:178247605-178247627 TTCTAAAATTTCTATTTGGTTGG - Intergenic
967836411 3:193967754-193967776 TTGAATAATTTCTAGTTGGCTGG - Intergenic
969208415 4:5666282-5666304 TTTTAAAATTTGTAGTTGCTGGG - Intronic
969993844 4:11291678-11291700 TTCCCAAGTTTCTAGATGGTTGG + Intergenic
970271281 4:14350646-14350668 TTAACAAGTGTCTTGTTGGTAGG + Intergenic
971225173 4:24745331-24745353 TTTAAAAATATGTTGTTGGTTGG + Intergenic
971703586 4:30011999-30012021 TTTATAAATTTCTCTTTGATTGG + Intergenic
971823489 4:31590651-31590673 TTTACAAATTTCTATGTAGAAGG + Intergenic
972099941 4:35402421-35402443 TTTAGCATTTTCTAGTTGCTAGG - Intergenic
973108484 4:46370689-46370711 TGTACAAACTTCTAGTTGCTAGG + Intronic
974194747 4:58558458-58558480 ATTACAAATTTCTAGGTGTTTGG + Intergenic
974822667 4:67087381-67087403 TTTTCAAATTTTTAAATGGTTGG - Intergenic
976693866 4:87897581-87897603 TTCACATATTTATAATTGGTGGG - Intergenic
977726200 4:100299739-100299761 TATACATATTTCCAGTTGCTGGG + Intergenic
977818354 4:101442560-101442582 TTTACAAATATGTAGTTCTTAGG - Intronic
978029361 4:103920346-103920368 TTTTAAAATTTCCATTTGGTTGG + Intergenic
978933516 4:114347201-114347223 CTTACTAATTTCCAGATGGTAGG - Intergenic
980516643 4:133870941-133870963 TTTTCAAATTTCTCTTTAGTAGG - Intergenic
982272014 4:153600067-153600089 TTTAAAAATAACTAGTTGCTGGG + Intronic
982524786 4:156465183-156465205 TTTACAGATTACAACTTGGTAGG - Intergenic
982614182 4:157619536-157619558 TTTGCAAATTTATTGTAGGTCGG - Intergenic
983726548 4:170935992-170936014 TTTACAAATTTCTTTTAGGCTGG + Intergenic
984171260 4:176362135-176362157 CTTACAAATTTCCAATTTGTTGG + Intergenic
984514694 4:180723882-180723904 TTTATATATTTCTAGTTTTTAGG + Intergenic
984765817 4:183399624-183399646 TTTAAAATTTTGTATTTGGTCGG - Intergenic
985829450 5:2217367-2217389 ATTGCACATTTCTAGTTGGGAGG - Intergenic
987130884 5:14858816-14858838 GATACAGATTTCTAGGTGGTGGG + Intronic
987968239 5:24905374-24905396 CTTACCAATTACTGGTTGGTTGG - Intergenic
989374146 5:40742119-40742141 TGTCCAATTTTCTAGTTGTTTGG + Intronic
991240238 5:64450467-64450489 ATTACAAATTTTTAATTTGTAGG + Intergenic
991350779 5:65718661-65718683 TTTAAAAATGTCTAGAAGGTGGG + Intronic
991455022 5:66793693-66793715 TCTCCAATTTTCTGGTTGGTTGG + Intronic
991680628 5:69135939-69135961 TTTACAATCTGCTATTTGGTGGG - Intergenic
992697069 5:79300112-79300134 TTAAAAAATTTCTAGCTGGTGGG - Intronic
993037719 5:82775508-82775530 TTTAAAAATTTCTAATTGCCAGG + Intergenic
993146336 5:84098082-84098104 TTTTCAGATTTCTAGTTTTTTGG - Intronic
994028232 5:95110041-95110063 TTTATAAATACCCAGTTGGTGGG + Intronic
995385529 5:111584735-111584757 TTTACAAATTGTGAGTAGGTTGG + Intergenic
996294536 5:121896062-121896084 TTGAGATATTGCTAGTTGGTTGG + Intergenic
997309571 5:132868572-132868594 TTTACAAATTTTTGTTGGGTCGG + Intergenic
997543730 5:134687059-134687081 TTTTTAAATCTATAGTTGGTAGG + Intronic
998704798 5:144746228-144746250 TTTACATTTTTCTAGTGGGATGG + Intergenic
998713784 5:144857294-144857316 TTGACAAATATCAAGGTGGTAGG - Intergenic
998970697 5:147588874-147588896 CTTACAAATTTCTTGGTGGGTGG + Exonic
999339427 5:150756983-150757005 TTTAAAAATCTCTAATTGGTTGG - Intronic
1000910828 5:167019914-167019936 TTTACCAAATTCTAGTTCTTTGG + Intergenic
1001011510 5:168103191-168103213 TTTACAAAATTGTAGTGGGGAGG - Intronic
1003218709 6:4137220-4137242 ATTACAAAGTGGTAGTTGGTAGG + Intergenic
1005266919 6:24121866-24121888 TTTACAAGTTTCTCTTTGGAAGG - Intergenic
1005415893 6:25599897-25599919 TGTACCAATTTCTACTTGGAAGG + Intronic
1006420847 6:33933014-33933036 TTTACAAACATCTGGTTGGGTGG - Intergenic
1007288272 6:40763907-40763929 TTTACAAATTTCTGTTTAGTAGG + Intergenic
1008772666 6:54998100-54998122 TTTTCAAATTTCTAGTGTGATGG + Intergenic
1009299415 6:61995834-61995856 TTTACAAATAGATAATTGGTGGG - Intronic
1009491530 6:64298335-64298357 TTCAAAAATTACTAGTTGGGGGG + Intronic
1010424400 6:75710978-75711000 TTTACAAAAATTTAGTTTGTTGG - Intronic
1012770181 6:103424002-103424024 TTTAAAAATTTCTAGTGCCTGGG - Intergenic
1013019325 6:106196837-106196859 GTTGCCAATTTCTAGTTTGTGGG - Intronic
1013137044 6:107292540-107292562 AATACAAATTTCTTTTTGGTTGG - Intronic
1013871902 6:114773779-114773801 TTTACACATTTTAAGTTGGGTGG + Intergenic
1014338919 6:120177390-120177412 TCTATAAATTTCTAGGTGGAAGG + Intergenic
1014503279 6:122221279-122221301 ATTACAGATGTCTATTTGGTGGG - Intergenic
1016786804 6:148019853-148019875 TATTCAATTCTCTAGTTGGTAGG + Intergenic
1016860145 6:148709609-148709631 TTTACAATTATCTCTTTGGTTGG + Intergenic
1017224651 6:152006870-152006892 TTTACAAAAAGCTAGGTGGTTGG - Intronic
1017393204 6:153964290-153964312 TTTAAAAATTTTTATTTTGTGGG - Intergenic
1018276199 6:162134085-162134107 TTTACAAAACTCTATATGGTAGG + Intronic
1018598005 6:165504135-165504157 TTTACCTATCTCTACTTGGTAGG - Intronic
1018880244 6:167870952-167870974 TCTACAACTTCCTAGGTGGTAGG + Intronic
1021395902 7:20147872-20147894 CTTACCAATTCCTAGTTGGGAGG + Intronic
1021712820 7:23433241-23433263 TTTAAAAATATCTTGTTGCTGGG - Intronic
1022450650 7:30511240-30511262 TTTTAAAATTTCTATTTTGTGGG - Intronic
1023295013 7:38705668-38705690 TTTAAAAATTTTTTTTTGGTGGG - Intergenic
1024252561 7:47517467-47517489 TTTACAAACATCTGGTTTGTTGG - Intronic
1024272326 7:47651743-47651765 TTTACAAAATTCTTGTGAGTTGG - Intergenic
1024647023 7:51379423-51379445 TTTAAAAATTTTTTATTGGTGGG - Intergenic
1024742210 7:52366515-52366537 TTAATAAGTTTCTAGATGGTAGG + Intergenic
1025754034 7:64317091-64317113 TTAAAAAATTTCTACTTTGTAGG + Intronic
1027123596 7:75539824-75539846 TTTACAAATGCCTAAATGGTAGG + Intronic
1028261794 7:88674897-88674919 TTCAGAAATTTCTTCTTGGTTGG - Intergenic
1028822445 7:95228455-95228477 TTTACCAATTTCCCTTTGGTGGG + Intronic
1029859156 7:103550877-103550899 ACTACTAATTTCTAGTTGGAAGG - Intronic
1033685836 7:143640603-143640625 TATACAAATTTCCAGTTAGCGGG + Intronic
1033689907 7:143726712-143726734 TATACAAATTTCCAGTTAGCGGG - Intronic
1033698778 7:143817018-143817040 TATACAAATTTCCAGTTAGCGGG - Intergenic
1034070572 7:148180813-148180835 TTTACAGATTTCTAGGTGTAGGG - Intronic
1034579260 7:152028316-152028338 TTTACAGAGTGCTAATTGGTCGG + Intronic
1036735014 8:11305604-11305626 TTTCCAGATGTATAGTTGGTGGG + Intronic
1037694538 8:21211990-21212012 ATGACACATTTCTAGATGGTGGG - Intergenic
1042314032 8:67406697-67406719 TTTACAATTGTGGAGTTGGTAGG + Intergenic
1042633431 8:70845436-70845458 TTTATAAATTTCTTTTTTGTTGG - Intergenic
1043107646 8:76135232-76135254 TTTTCTAATTTATTGTTGGTAGG + Intergenic
1045782538 8:105884628-105884650 TTTAAAATTTTGTAGTTAGTAGG - Intergenic
1046713482 8:117541160-117541182 TTGACAAATGTCAAGTTGGAGGG - Intergenic
1048926378 8:139276176-139276198 TTTGCAAATTTGAAGGTGGTGGG - Intergenic
1051037147 9:12762219-12762241 TTAGCAAATCTCTAGATGGTGGG + Intergenic
1051087763 9:13370473-13370495 TTTACATATTTCTAGCATGTTGG - Intergenic
1052067691 9:24042743-24042765 TTTACAAATTACCAATTGCTGGG + Intergenic
1055850825 9:80627955-80627977 TTTACATTTTTCTAGTTATTGGG - Intergenic
1056138558 9:83652385-83652407 TTTACCTATTTCTCATTGGTTGG + Intergenic
1056258130 9:84821225-84821247 TTTAAAATTTTCAAATTGGTTGG + Intronic
1056428587 9:86504232-86504254 TTGCCAAATTACGAGTTGGTTGG + Intergenic
1056430099 9:86518942-86518964 TTTAAATAGTTATAGTTGGTGGG - Intergenic
1056958814 9:91103951-91103973 TTTGCCACTTTCTAGTTGTTTGG - Intergenic
1056977943 9:91277624-91277646 TTTAAAAATTTCTAAATGGCAGG + Intronic
1057976975 9:99616050-99616072 TTTAAAAATTTTTAAGTGGTTGG - Intergenic
1059016366 9:110520602-110520624 TTTACAAATTCCAAACTGGTTGG - Intronic
1059874171 9:118615345-118615367 TTTTCAAGTTTTTAGTTGCTGGG + Intergenic
1062193529 9:135259808-135259830 TTTCCAAATTTCTAGCTCGTTGG + Intergenic
1187630291 X:21161725-21161747 ATCTCAAATTTCTAGTTGCTTGG - Intergenic
1188926276 X:36048553-36048575 TTCACAGATTTCCAGCTGGTTGG - Intronic
1189100782 X:38187099-38187121 TTTACAAGTTTCTAATTTGAGGG + Intronic
1189577009 X:42364763-42364785 TTTACAAGTTTGTATTTGGCTGG - Intergenic
1191178504 X:57533916-57533938 TTTAGAAATGTCTAGATGGCAGG + Intergenic
1192395503 X:70776800-70776822 GTTACAAATATATAGTTGGAAGG + Intronic
1192625427 X:72722335-72722357 TTTAAAATTTTCTACTTGTTAGG - Intergenic
1192695883 X:73415658-73415680 TTTACAATCTACTAGTTGCTTGG + Intergenic
1194243870 X:91485656-91485678 TTCACAAATATCTAGTTTGGGGG + Intergenic
1194465217 X:94226359-94226381 TTTAAAAATTTCTAAATGATTGG + Intergenic
1194687543 X:96941152-96941174 TTTACAAACTTTTAGTAGGTTGG + Intronic
1194938481 X:99980264-99980286 TTTACAAAATTATAGATGGTAGG - Intergenic
1194976915 X:100405788-100405810 TTTTCAAATATCTGGTTGGTTGG - Intronic
1196011044 X:110888335-110888357 TTTTCAAATATCTAGTATGTTGG + Intergenic
1196592075 X:117497152-117497174 TTTAAAAATTTCTATTTGCTTGG - Intergenic
1197467584 X:126823042-126823064 TTTAGACGTTTCTAGTTGATTGG - Intergenic
1198041321 X:132855662-132855684 TTTACAAATTTCTAGTTGGTGGG - Intronic
1198457159 X:136828134-136828156 TTTCCAGGATTCTAGTTGGTGGG - Intergenic
1198465997 X:136905449-136905471 TTTAAAAAATTTTATTTGGTCGG + Intergenic
1199355549 X:146859331-146859353 TTTACAAATTTCTACTTTGAAGG - Intergenic
1200562851 Y:4727018-4727040 TTCACAAATATCTAGTTTGGGGG + Intergenic
1201322765 Y:12718420-12718442 TTTTTAAATTTCTATTTGTTTGG + Intronic
1201339046 Y:12912003-12912025 TTTAGAAATTTTAATTTGGTAGG + Intronic
1201596131 Y:15671445-15671467 TTTACACATTTACAGTTGGTGGG - Intergenic