ID: 1198042991

View in Genome Browser
Species Human (GRCh38)
Location X:132872994-132873016
Sequence CAGGAAGTGATGGGCTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 485}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198042991_1198042997 1 Left 1198042991 X:132872994-132873016 CCAACCCAGCCCATCACTTCCTG 0: 1
1: 0
2: 5
3: 49
4: 485
Right 1198042997 X:132873018-132873040 AATCTCTCAAAACTGCATTAAGG 0: 1
1: 0
2: 0
3: 14
4: 239
1198042991_1198042998 19 Left 1198042991 X:132872994-132873016 CCAACCCAGCCCATCACTTCCTG 0: 1
1: 0
2: 5
3: 49
4: 485
Right 1198042998 X:132873036-132873058 TAAGGCCAGTTAAACATCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198042991 Original CRISPR CAGGAAGTGATGGGCTGGGT TGG (reversed) Intronic
900158174 1:1211836-1211858 CAGGAAGGGGTCTGCTGGGTGGG + Intronic
900299404 1:1969417-1969439 TTGGAAGGGATGGGCTGGGCTGG - Intronic
900748402 1:4377179-4377201 CAGGAAGTGGGTGCCTGGGTTGG + Intergenic
901055919 1:6448556-6448578 CAGGAGGTGAAGAGCTGGGTGGG + Intronic
902082962 1:13833749-13833771 CAGGAAGAGAGGGGGTGGGAAGG + Intergenic
902243605 1:15104271-15104293 CAGTAAGTGATGGGCCAGGATGG - Intronic
902399811 1:16151714-16151736 CAGGATGTGAGGGGCAGGGGTGG - Intronic
902478475 1:16700083-16700105 CAGGAGGTGAAGAGCTGGGTGGG - Intergenic
902891300 1:19445909-19445931 CAGGGAGTGCTGGGCTGTGCAGG + Intronic
903335849 1:22623968-22623990 CAGTGGGTGATGGGCTGGGTGGG + Intergenic
903348410 1:22702677-22702699 CAGAAAGTAAAGGGCTGAGTTGG + Intergenic
903900375 1:26640447-26640469 CAGGAGGTGATGGGCGGCATTGG - Intergenic
903901295 1:26647591-26647613 CAGGAGGTGATGGGCGGCATTGG + Intergenic
904042375 1:27592350-27592372 GTGCAGGTGATGGGCTGGGTGGG - Intronic
904556379 1:31367534-31367556 CAGGAATTGAGGGGCAGGGTGGG + Intronic
904655652 1:32044449-32044471 GAGGAAGTGATGGAATTGGTTGG + Intronic
905172096 1:36115382-36115404 CAGGAGGGGCTGGGCTGGGCAGG + Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906288462 1:44603692-44603714 GAGGAAGAAAAGGGCTGGGTGGG - Intronic
907186334 1:52612195-52612217 CACTAAGTGATGGCCTTGGTGGG - Intergenic
907319826 1:53595196-53595218 GAGGAAGAGAAGGGCTGGGGAGG + Intronic
907453188 1:54560277-54560299 GAGGAGGTGATGGGTTAGGTTGG + Intronic
910648205 1:89536106-89536128 TAGTAAGTGATGTGTTGGGTGGG - Intronic
912469833 1:109898986-109899008 CAGGAGGTGGTGGGTGGGGTGGG + Intergenic
914205000 1:145519068-145519090 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914484119 1:148092250-148092272 CAGGAGCTGATGGGGTGGGAGGG - Intergenic
914967876 1:152277528-152277550 CAGGCAGTAATGGGCTGCTTGGG - Intergenic
915784809 1:158597837-158597859 CTGAATGTGATGGGCTTGGTAGG - Intergenic
915980960 1:160419699-160419721 CTGGAGGTGATGGGCTTGGAGGG + Intronic
916124481 1:161557166-161557188 CAGGAAGTGAGGGGCAGGTGGGG - Intergenic
916134373 1:161638516-161638538 CAGGAAGTGAGGGGCAGGTGGGG - Intronic
917967568 1:180188113-180188135 CAGCTAGTGAGGGGCTGGGCAGG + Intronic
917990986 1:180378745-180378767 GTGGCAGTGGTGGGCTGGGTGGG - Intronic
918450162 1:184650098-184650120 GAGGAAATGAGGGGCTGGGGTGG - Intergenic
919736129 1:200952314-200952336 CAGAGAGTGAGGGGCGGGGTGGG - Intergenic
919940244 1:202281466-202281488 CAGGAAATGATGGGAGGGTTTGG - Intronic
920147237 1:203872537-203872559 CAGGAAGGGATGGGCTGGGAGGG + Intergenic
920176117 1:204102962-204102984 CCGGAAGAGCTGGGCTGGCTGGG + Intronic
920284148 1:204867828-204867850 CAGGCAGCCATGGGCTGAGTCGG - Intronic
920285204 1:204874159-204874181 CAGGAAGATTTCGGCTGGGTAGG - Intronic
920498633 1:206472671-206472693 CAGGAAGTGGTGGGCCTGGCAGG + Intronic
921047092 1:211485309-211485331 CGGGAAGTGAGGGGATGGGGAGG - Intronic
921958594 1:221010865-221010887 CAGGAAATTCTGGGCTGTGTGGG + Intergenic
923995798 1:239492778-239492800 CAGGCAGCAATGGACTGGGTAGG - Intronic
1064110195 10:12532045-12532067 CTGGAAATGATGGGCTGGGCTGG - Intronic
1064144377 10:12815821-12815843 CAGGACCTGATGGGCTGAGCAGG + Intronic
1064604619 10:17026062-17026084 CAGGAACTACAGGGCTGGGTAGG - Intronic
1067977744 10:51044719-51044741 TAGGAAGTGTTGGGCTAGGTGGG + Intronic
1068079596 10:52303501-52303523 CTTGAAGTAATGGGCTGGCTAGG + Intergenic
1068936994 10:62645722-62645744 AGGGAAGTGATGGGATGGATGGG + Intronic
1069319274 10:67147963-67147985 CAGAAATTAATGGGATGGGTGGG + Intronic
1069662263 10:70131697-70131719 CCAGAAGTGATGGGCTGGGCAGG - Intronic
1069835117 10:71303302-71303324 AAGGGAGTGATGGGCAGGTTGGG + Intergenic
1069856218 10:71442657-71442679 CAGGAAGCGAAGGCCTGGGCAGG + Intronic
1070332890 10:75430905-75430927 CAGGTGGGGATGGGGTGGGTGGG + Intergenic
1071315156 10:84388438-84388460 CATGAAGTGGTGGGAAGGGTTGG + Intronic
1072618175 10:97063347-97063369 CAGGAGGTGATGGGCAGGCCAGG + Intronic
1072658811 10:97349491-97349513 CATGAAGGGAAGGGCTGGGCTGG - Intergenic
1073496805 10:103899090-103899112 CAGTAAATGAGGTGCTGGGTGGG + Intronic
1074258150 10:111824454-111824476 CTGGAAGTGAGGGGCTGGCCTGG + Intergenic
1075234453 10:120713943-120713965 CTGGCAATGATGGGCTGGCTGGG + Intergenic
1075653748 10:124147521-124147543 CAGGAGGTGGTGGGGTGGGCTGG - Intergenic
1075673500 10:124280413-124280435 CAGGAAGGGCAGGGCTGGGCTGG + Intergenic
1075925907 10:126251807-126251829 CATGAATTGATGGGATGGATAGG + Intronic
1076079881 10:127569801-127569823 CAGCATGTGTTGGGCTGGGGTGG + Intergenic
1077094205 11:792486-792508 CAGGAGGTGGTGGGGTGGGCAGG + Intronic
1077172221 11:1172173-1172195 GAGGCTGTGAGGGGCTGGGTGGG + Intronic
1077278934 11:1733274-1733296 CAGGCAGTGGTGGGATGGGAGGG - Exonic
1078675408 11:13408022-13408044 GAAGAATTGATGGGCTGGGGTGG - Intronic
1079298352 11:19254875-19254897 CAGGAAGTGATGGGCAAGGCTGG - Intergenic
1079383404 11:19958435-19958457 GAGGAAGTGATGGCTTGTGTTGG + Intronic
1080600394 11:33816710-33816732 CAGGAACTGCTGGACTGGGGTGG - Intergenic
1080696687 11:34608880-34608902 CAGAAAGGGATGGCCTGGGTGGG + Intergenic
1083157915 11:60836832-60836854 CAAGAAGAGGTGGGGTGGGTTGG - Intergenic
1083194793 11:61079426-61079448 CAAGAACTGAGGGGCAGGGTGGG + Intergenic
1083892716 11:65604712-65604734 GAAGAGGCGATGGGCTGGGTGGG + Intronic
1084273405 11:68040464-68040486 GAGGAAGTGACTGGCTGGGCAGG + Intronic
1084337959 11:68472191-68472213 CAGGAAGTGATGATGTTGGTGGG + Intronic
1084809877 11:71605614-71605636 CAGTAAGTGAGGTGCTGAGTTGG - Intergenic
1085231315 11:74973534-74973556 CAGGAAGCAATGGTCAGGGTGGG - Intronic
1085293219 11:75415028-75415050 CTGGAGGTGGTGGACTGGGTGGG - Intronic
1085524136 11:77154627-77154649 CAGGAAGAGCTGGGGTGGGGTGG - Intronic
1086249316 11:84795090-84795112 CAGGCAGTGATGGGTGGGGTGGG - Intronic
1087090812 11:94270643-94270665 CAGGGGGTGAGGGGCTGGGGAGG + Intergenic
1087151093 11:94860600-94860622 GAGGCAGTGAGGGGCTGGATGGG - Intronic
1087211824 11:95452889-95452911 AAGGAAGGGAGGGGCTGGGAAGG - Intergenic
1087805365 11:102549434-102549456 CAGGAAGTTATTGGCTTGGTGGG + Intergenic
1087992183 11:104758513-104758535 CAGGTAGTGCCAGGCTGGGTGGG - Intergenic
1088749842 11:112834384-112834406 CAGGAAATGAGGGGCTGGCATGG - Intergenic
1089036320 11:115396734-115396756 AAGGAGATGATGGGCTGGGAAGG + Intronic
1089613819 11:119684279-119684301 CAGGAAAGGAGGGGCTGGGGTGG - Intronic
1089687866 11:120168546-120168568 CAACAAGTGATGGCCTGGGGCGG + Intronic
1090081217 11:123614122-123614144 AAGGATGTGAATGGCTGGGTGGG - Intronic
1090206126 11:124885367-124885389 CTGGGACTGATGGGCTGAGTTGG - Intronic
1090333488 11:125948180-125948202 GAGGAAGGGATGGTCAGGGTGGG + Intergenic
1090975466 11:131676385-131676407 AAAGAAGTGAAGGGCTGCGTTGG + Intronic
1091231574 11:133991237-133991259 CAGGATGTGGTGGGTGGGGTGGG - Intergenic
1093581035 12:20784083-20784105 CAGGTAGTCATGGGCTTGGCGGG - Intergenic
1094187218 12:27657716-27657738 CAGTAGGTGATGGGGTGGGGCGG - Intronic
1096256395 12:50064577-50064599 CTGGAAGTGGAGGGCTGGGGAGG + Intronic
1096368475 12:51048368-51048390 CAGGGTGTGCTGGGCTCGGTCGG + Exonic
1096576757 12:52557708-52557730 CAGGAAGGGAGGGCCTAGGTGGG + Intergenic
1096579683 12:52576646-52576668 TCAGAAGTGATGGGCTGGGGAGG + Intergenic
1098384743 12:69907039-69907061 CAGTAAGTGCTGGCCTGGGTAGG + Intronic
1098703974 12:73664563-73664585 CAGGAAGGGGTGGGTTGAGTAGG + Intergenic
1100992468 12:100266375-100266397 CAGAAAGTGATGGGCGGAGGTGG + Intronic
1101015731 12:100498138-100498160 GAGGAAGGAATGGGCTGTGTGGG + Intronic
1101871752 12:108571469-108571491 CATCACCTGATGGGCTGGGTGGG + Intergenic
1102440596 12:112961294-112961316 GAGGAACTGATTGGCTGGGGTGG - Intronic
1103981075 12:124737334-124737356 CTGGAAGAAAGGGGCTGGGTGGG - Intergenic
1104327527 12:127813296-127813318 CAGGAAGAGATGTGCTGTGGTGG - Intergenic
1104797188 12:131528041-131528063 CAGGTAGCAATGGGCTGTGTGGG - Intergenic
1104963894 12:132500580-132500602 CAGGAAACTATGGACTGGGTGGG - Intronic
1105210808 13:18255704-18255726 CAAGAGATGATGGCCTGGGTGGG + Intergenic
1105283243 13:18982212-18982234 AAGGAAGAAATTGGCTGGGTGGG - Intergenic
1105294207 13:19074100-19074122 CAGGAAGAGATGAGCTGGGAAGG - Intergenic
1105605772 13:21925487-21925509 CAGGAACACATGGCCTGGGTTGG + Intergenic
1105732634 13:23233809-23233831 CCGGTAGTCAAGGGCTGGGTAGG + Intronic
1107407315 13:40126927-40126949 CAGGAAGTGAGGGGTGGGGAAGG + Intergenic
1107723363 13:43273088-43273110 CAGGAAGTGAAGGGTCTGGTAGG - Intronic
1108350449 13:49586053-49586075 CAGGAAGTGAGGGGCGGGGAGGG - Intergenic
1108487738 13:50944000-50944022 CAGGACGGGATGGGATGGGACGG + Intronic
1108583765 13:51849864-51849886 CAGGAAGCGATGGGGAGGGAGGG - Intergenic
1108862011 13:54872476-54872498 CAGGCAGAGATGTGCTGGGTAGG + Intergenic
1110928409 13:81184900-81184922 CAGGAACTGATGGGTGGGGTGGG - Intergenic
1113613569 13:111665033-111665055 CAGGTGGTGCTGGGCTGGGGTGG + Intronic
1115518526 14:34209497-34209519 CAGCAAGTGCTAGGCTGGGAAGG + Intronic
1116315140 14:43376463-43376485 CAGGAGTTGAGGGGCTGGGAGGG + Intergenic
1118722931 14:68607433-68607455 CTGGAAGAGATGGGCTGTGGGGG - Intronic
1119001183 14:70883485-70883507 CAGGATGTCAAAGGCTGGGTAGG - Intergenic
1119437948 14:74610544-74610566 TGGGCAGTGAGGGGCTGGGTGGG - Intronic
1119438630 14:74613380-74613402 GAGAGAGTGAAGGGCTGGGTGGG - Intergenic
1119675204 14:76548287-76548309 CAGGAAGGGTTGGGCAGGGAGGG - Intergenic
1120568283 14:86086229-86086251 CAGGGAGTGGGGGGCTGGGGAGG - Intergenic
1120626411 14:86831974-86831996 GTGGCTGTGATGGGCTGGGTGGG - Intergenic
1121413239 14:93762169-93762191 CAGGAAGTGCTGGATTGGGCTGG - Intronic
1122033750 14:98932860-98932882 GAGGAAGTGAGGTGCAGGGTAGG - Intergenic
1122402122 14:101473701-101473723 CGGGAAGTGATGGGGTTGGTGGG + Intergenic
1122771918 14:104101392-104101414 TGGGAAGTGAGGGGCTGGGCTGG + Intronic
1122916875 14:104863572-104863594 CAGGAAAGGATGGGCAGGGCTGG + Intergenic
1123084444 14:105711085-105711107 CGGGATGGGATGGGCTGGGCTGG - Intergenic
1124139380 15:27063955-27063977 CAGTAAGGGATGGACTGTGTGGG - Intronic
1124222745 15:27864139-27864161 CTGGTACTGATGGGCTGTGTGGG - Intronic
1124271298 15:28282961-28282983 CAGGAAGGGATGGGACGGGACGG + Intronic
1124666510 15:31597737-31597759 CAAGAAGGGCTGGGCAGGGTGGG - Intronic
1124706698 15:31972408-31972430 CAGGAAGAGGTGGGCTTGGGTGG + Intergenic
1124872700 15:33558941-33558963 TAGAAAGGGATGGGCTGGCTAGG + Intronic
1125078211 15:35645733-35645755 CAGGTAGTGGTGGGCTTGCTGGG + Intergenic
1125684551 15:41556132-41556154 AAGGAAGTAAAAGGCTGGGTTGG + Intergenic
1126661601 15:51038606-51038628 GTGGCTGTGATGGGCTGGGTAGG + Intergenic
1128312597 15:66640638-66640660 CAGCAAGTGAGAGGCTGAGTGGG - Intronic
1128565727 15:68699503-68699525 CAGGAAGGGAGGGGCTGGCCTGG + Intronic
1128722292 15:69958951-69958973 CAGGCAGTGATCAGATGGGTAGG - Intergenic
1129539070 15:76336617-76336639 CAGGGGCTGATGGGCGGGGTGGG - Intergenic
1129794061 15:78362733-78362755 CTTGAAGAGTTGGGCTGGGTTGG - Intergenic
1129851330 15:78795572-78795594 CAGGAGGTGAGGGGCTGGCAGGG + Intronic
1130297408 15:82656908-82656930 TTGGAAGAGATGGGCTGGGCTGG + Intergenic
1130352584 15:83105591-83105613 ATGGAAGGGATGGGCTGGCTTGG + Intergenic
1132700103 16:1218665-1218687 CAGGAAGATATGGGCTGGGTGGG + Intronic
1133052399 16:3124569-3124591 CAGGAAGTCAGTGGCTGGGCGGG - Intergenic
1133292196 16:4729649-4729671 CAGAAAGTGATGGCCTGGTGCGG - Intronic
1133699515 16:8295868-8295890 CAGGAAGAGGTGGGGTGGGTGGG + Intergenic
1134880904 16:17744980-17745002 CTGGGAGGGAGGGGCTGGGTGGG + Intergenic
1136233309 16:28900465-28900487 CAGGAAGTGGTGGGGAGGGGTGG - Intronic
1136590202 16:31214035-31214057 CCGGAAGTGATGGGAGGGATTGG + Exonic
1136939333 16:34506950-34506972 CAGGAAGTAATGGGCTAAATTGG - Intergenic
1137768302 16:50994784-50994806 CAGGAAGTGATGGCCAGGTCAGG + Intergenic
1138417220 16:56878276-56878298 CAGGGAGAGCTGGGCTGGGAGGG + Intronic
1138423690 16:56916405-56916427 TAGGAAGTGGTGGGCTGGGAAGG - Intergenic
1138423881 16:56917496-56917518 TAGGAAGTGGTGGGCTGGGAAGG - Intergenic
1138693624 16:58791088-58791110 CAGGTAGGCATGGGCTTGGTGGG - Intergenic
1138712671 16:58986835-58986857 CTGGTGGTGATGGGCAGGGTGGG - Intergenic
1139870716 16:70106969-70106991 AAGGAAATGCAGGGCTGGGTGGG + Intergenic
1140384732 16:74525585-74525607 AAGGAAATGCAGGGCTGGGTGGG - Intronic
1141980701 16:87548206-87548228 GAGGAAGTGCTGGGGAGGGTGGG + Intergenic
1142427732 16:90009548-90009570 CAGCAGGTGATGGGATGGCTGGG + Intronic
1142429417 16:90018510-90018532 CAGGAGGTGGTGGGCTTGGCTGG + Intronic
1142523985 17:525319-525341 GAGGAAGAGATGGGCAGGGTGGG + Intronic
1143181383 17:4986500-4986522 CAGGAAGAAATGGGTTGGGGTGG + Intronic
1143335210 17:6167015-6167037 CAGGAAGATATGGGCTTGGGAGG + Intergenic
1143388090 17:6543850-6543872 AAGGAAGGGGTGGGCAGGGTTGG + Intronic
1144215788 17:13053994-13054016 CAGGAACGAATGTGCTGGGTGGG + Intergenic
1144965929 17:19077390-19077412 CAGGGAGGAAGGGGCTGGGTGGG + Intergenic
1144982039 17:19174799-19174821 CAGGGAGGAAGGGGCTGGGTGGG - Intergenic
1144986184 17:19203440-19203462 CAGGGAGGAAGGGGCTGGGTGGG + Intergenic
1145964071 17:28904384-28904406 CAGGAAGGGTGGGGCTGGCTAGG + Intergenic
1146804352 17:35853356-35853378 CTAGAAGTGATGGGGTAGGTTGG + Intronic
1146826410 17:36027204-36027226 GAGGAAGGGGTGGGATGGGTGGG - Intergenic
1147692229 17:42323391-42323413 TAGGAAGGGAAGGGCTGGGATGG - Intronic
1147870589 17:43584502-43584524 AAGTAGGTGATGGGCTGGGGTGG - Intergenic
1148028255 17:44603043-44603065 AAGGAAGTGATAGCCTAGGTTGG + Intergenic
1148044454 17:44734240-44734262 CAGGAAGAGATGGTTTGGGTGGG - Intronic
1148478614 17:47945633-47945655 CAGCCTGGGATGGGCTGGGTTGG + Intronic
1149552775 17:57552383-57552405 CAGTGAGTGGGGGGCTGGGTTGG - Intronic
1150246666 17:63681153-63681175 CAGGAAGTGTGGGAGTGGGTAGG + Intronic
1150711489 17:67534270-67534292 AAGGAAGAAATGGGCTGGATAGG - Intronic
1151183989 17:72350114-72350136 CAGGCTGTGATGGGCAGGGTAGG - Intergenic
1152546770 17:81004193-81004215 CGGGAAGGGCTGGGCTGGGCTGG - Intronic
1152754440 17:82081353-82081375 CTGGAAGGGATGCGCCGGGTCGG + Intronic
1152794059 17:82298267-82298289 CCGGAAGTTGTGGGCTGGGAGGG + Intergenic
1152929909 17:83104181-83104203 CAGGAAGTGGAGGGGAGGGTAGG - Intergenic
1152944297 17:83190754-83190776 CAGGAACTGGGGGGCTTGGTGGG - Intergenic
1153071230 18:1106852-1106874 CAGGATGGGATGGGATGGGGTGG - Intergenic
1153584219 18:6604702-6604724 GAGGGAGTGTTGGGCTGGGCTGG - Intergenic
1153871031 18:9320305-9320327 CAGGAAGGGCTTGGCTGGGTGGG - Intergenic
1154332695 18:13442670-13442692 CAGGACGTGCTTGGCTGGGCAGG - Intronic
1154467863 18:14667313-14667335 CACCTACTGATGGGCTGGGTTGG + Intergenic
1155033325 18:22002875-22002897 CAGGCAGTGGTGTGATGGGTGGG + Intergenic
1156388433 18:36627476-36627498 CTTGAAGTGCTGGGCTCGGTAGG + Intronic
1156470258 18:37373393-37373415 CAGGTAGTGATGGGCCAGGATGG - Intronic
1156570087 18:38243104-38243126 CAGGTAGAGATGGTCTGGGGAGG - Intergenic
1157476929 18:48029515-48029537 CAGGAAGTGCTTGGCGGGGCTGG + Exonic
1157570441 18:48708844-48708866 CAGGAAGTGATTTGCAGGGAGGG - Intronic
1157595443 18:48861090-48861112 CGGGAGGTGATGGGCGGGGAAGG + Exonic
1157762332 18:50274105-50274127 CTGGAAGTGGTGGGCAGGCTTGG - Intronic
1157820815 18:50767267-50767289 CAGGCTGTGGTGGGCAGGGTGGG - Intergenic
1158249827 18:55475367-55475389 CTGGAAGTGATGTCCTGGGAAGG - Intronic
1158392402 18:57054015-57054037 CAGGAGATGAGGGGGTGGGTGGG + Intergenic
1159024997 18:63175600-63175622 CAGGAAGTGAAGGGGTGGCCTGG + Intronic
1159076130 18:63683978-63684000 TAGGAAGTGGTGGGATGGGCTGG - Intronic
1160859889 19:1233323-1233345 CAGGAGGTTGTGGGCTGGGTGGG - Intronic
1160990557 19:1858729-1858751 CAGGAGGTCCTGGCCTGGGTTGG - Intronic
1161363367 19:3864027-3864049 CAGGAAGTGGGAGGCGGGGTTGG - Intronic
1161687155 19:5708446-5708468 CAGCAGGGGGTGGGCTGGGTGGG + Intronic
1161733711 19:5977863-5977885 CCGGGAGTGATGGGCCGGGCCGG + Intronic
1161770919 19:6230297-6230319 CAGGAAGTGCTGGGAAGGGATGG - Intronic
1161848281 19:6724888-6724910 CCGGGAATGCTGGGCTGGGTGGG - Intronic
1161996104 19:7712508-7712530 CAGGTGGTGGTGGGCGGGGTGGG + Intergenic
1162336944 19:10067683-10067705 TAGGAATTGATGGGGTCGGTGGG + Intergenic
1162403073 19:10457678-10457700 CAGGAGGTGGTGGGCTGGAGTGG - Intronic
1162582523 19:11539757-11539779 GAGGAAGTGGGGGACTGGGTTGG + Intronic
1162743047 19:12783917-12783939 CAGGAAGTGAGAGGCGGGGCAGG + Intronic
1162768033 19:12931860-12931882 CAGTAAGTGAAGGGCAGAGTTGG - Intronic
1163103023 19:15109008-15109030 CAGGCAGTGAGGGGCTGGGTGGG + Intronic
1163301473 19:16449988-16450010 AAGGAAGAGATGGGCTGGGAGGG + Intronic
1163655251 19:18542066-18542088 CAGAAAGTGATCGGCAGTGTGGG - Intronic
1163727246 19:18929639-18929661 CAGGAAAGGGTGGGCAGGGTTGG + Intronic
1164324309 19:24178647-24178669 CAGAAAGTGGTGGGCAGCGTTGG + Intergenic
1164560340 19:29287751-29287773 CCAGAAGTGATGGGCTGTCTTGG + Intergenic
1166282966 19:41807490-41807512 CAGGAAGTGATGGCCAGCCTGGG - Intronic
1168148306 19:54431453-54431475 CAGGAAGGGACGGGGAGGGTGGG - Intronic
1168403187 19:56097880-56097902 CAGTAAGAGATGGGGTGGGGAGG + Intronic
1168405519 19:56108350-56108372 CAGGGAGTGCTGGGCAGGGGCGG - Intronic
1202712494 1_KI270714v1_random:25914-25936 CAGGAGGTGAAGAGCTGGGTGGG - Intergenic
925051365 2:818274-818296 CAGGCAGATATGGCCTGGGTGGG - Intergenic
925231310 2:2236213-2236235 TGGGATGTGCTGGGCTGGGTTGG - Intronic
925231404 2:2236533-2236555 TGGGATGTGCTGGGCTGGGTTGG - Intronic
925231426 2:2236613-2236635 TGGGATGTGCTGGGCTGGGTTGG - Intronic
925394487 2:3522982-3523004 CAGCAAGTGCTGGGCTGCCTTGG - Intergenic
925673742 2:6338891-6338913 CAGGCAGTGATTGACTGGGAGGG + Intergenic
925886297 2:8396010-8396032 GAGGAAGGGATGGCCTGGATGGG - Intergenic
926149726 2:10418498-10418520 AAGGAAGTGGTGGGCAGTGTGGG + Intronic
926172460 2:10560966-10560988 CAGCAAGTGTTCGGGTGGGTGGG + Intergenic
926190373 2:10723125-10723147 GGGGAGGTGATGGGCTAGGTGGG + Intronic
926233976 2:11025674-11025696 CAGGAAGTGTTGTGGCGGGTGGG - Intergenic
927843646 2:26460553-26460575 CAGGAAGAGATGGGGTGTCTGGG + Intronic
929199197 2:39217649-39217671 CAGAAAATAATGGGCTGGGATGG - Intronic
929484685 2:42342884-42342906 CAGGATGTGTTGGGATGGGCAGG - Intronic
929761511 2:44811153-44811175 CAAGAAGCAATGGGCTGGGAGGG - Intergenic
929812315 2:45200991-45201013 CAGGCTGTGATGGGCAGGGTGGG - Intergenic
929812378 2:45201224-45201246 GTGGCAGTGATGGACTGGGTCGG - Intergenic
930847365 2:55920201-55920223 AAGGAAGTGATGACCTTGGTTGG - Intronic
931634264 2:64327768-64327790 CAGGAAGCCGTGGGCTGGGAGGG + Intergenic
932092718 2:68820732-68820754 CAGTGAGGGATGGGGTGGGTGGG - Intronic
932453064 2:71828137-71828159 CAGGGATGGAGGGGCTGGGTGGG - Intergenic
932775493 2:74525855-74525877 CAGGAAATGCTGGGAAGGGTGGG - Intronic
933701029 2:85255648-85255670 CAGGGACTGAAGGGCTGGGAAGG - Intronic
934954837 2:98608674-98608696 GAGGAGGTGGTGGGCTGGTTCGG + Exonic
935414645 2:102802629-102802651 CAGGAAGTGTTAGGATGGGTAGG + Intronic
936041190 2:109150724-109150746 CAGGAAGTGGAGGTGTGGGTTGG + Intronic
936146896 2:109986445-109986467 GAGGGAGTGATGGCTTGGGTAGG + Intergenic
936197796 2:110385038-110385060 GAGGGAGTGATGGCTTGGGTAGG - Intergenic
936255152 2:110904754-110904776 CAGGAAGAGATGGGCAGGGTTGG + Intronic
937243536 2:120477664-120477686 CAGGAGGTGATGGGCAGAGGTGG - Intergenic
938124704 2:128663521-128663543 CAGGCAATCCTGGGCTGGGTGGG + Intergenic
938214546 2:129499921-129499943 CAGGAAGTGGTGTGGTCGGTTGG - Intergenic
939180125 2:138794596-138794618 CAGCAAGTGAGGCTCTGGGTGGG - Intergenic
940987150 2:160061806-160061828 AAGGAAGGGATGGACTGGGGAGG + Intronic
941659837 2:168184526-168184548 CATAAAGTGAGGGGGTGGGTTGG - Intronic
943090817 2:183372894-183372916 CAAAAAGGGATGGGATGGGTGGG - Intergenic
943369779 2:187002397-187002419 CAGGAAGTGATGGCCTGCGGTGG - Intergenic
945924705 2:215791440-215791462 AAAGAAGTGATGGGCTGAATAGG - Intergenic
946409901 2:219510706-219510728 GAGAAGGTGCTGGGCTGGGTTGG + Intergenic
946414585 2:219533476-219533498 CAGGAGTTGACGGGCTGTGTGGG - Intronic
946884635 2:224210722-224210744 CAAGAGGTCATGGGCGGGGTAGG + Intergenic
947711695 2:232320075-232320097 CAGGAAGGGGTAGGGTGGGTGGG - Intronic
948523804 2:238558417-238558439 CAGGAAGTGCTGTTCTGGGCAGG - Intergenic
948853639 2:240720117-240720139 CAGGAAGTGCTGGGCTTGGTGGG + Intronic
949003703 2:241633286-241633308 CGGTAAGTGATGAGCTGGGAGGG + Exonic
1168754240 20:305093-305115 CAGGAAGGGAAGTGCTGGGAAGG + Intergenic
1169761141 20:9095848-9095870 AAGGTTGTGATGGGCTGTGTAGG - Intronic
1169867645 20:10218348-10218370 AAGGTAGTGATGGGAGGGGTGGG - Intergenic
1170627420 20:18040375-18040397 TAGGACGTGATGGGCTGGGATGG + Intronic
1171291948 20:23987393-23987415 CAAGAGATGATGGCCTGGGTGGG + Intronic
1171878799 20:30601516-30601538 CAGGAAGAGATGAGCAGGGAAGG - Intergenic
1172595242 20:36146677-36146699 CTGGAAGTGAAGTGCTGGCTGGG + Intronic
1172772670 20:37390805-37390827 CAGCAAGTGGTGAGCTGGGATGG + Intronic
1173576959 20:44118471-44118493 CAGGGAAGGATGGGCAGGGTAGG - Intronic
1173664531 20:44754952-44754974 CAGGGAGGGCTGGGCTGGGAAGG + Intronic
1173788849 20:45814469-45814491 CAGTAAGTGTAGGGCTGGGATGG + Exonic
1174073608 20:47916326-47916348 CAGGATGGAATGGGGTGGGTGGG + Intergenic
1174376445 20:50129513-50129535 CAGCTAGTGGTGGGCTGGGAGGG - Intronic
1174775298 20:53338247-53338269 AAAAGAGTGATGGGCTGGGTTGG + Intronic
1175593588 20:60213029-60213051 CAGGAAGGAATGGGCCGGGGAGG + Intergenic
1175696864 20:61109168-61109190 CAGGAGGTCATGGGCTGTGGTGG - Intergenic
1176168501 20:63686671-63686693 CCGGAAGGGAAGGGCTGGGAGGG + Intronic
1176188178 20:63793012-63793034 CAGGAAGTGAAGGGGAGGCTGGG - Intronic
1176198046 20:63846624-63846646 CTGGAAGTGAAGGGTTGGGATGG - Intergenic
1177095901 21:16832252-16832274 CGGGAATTGAGGGTCTGGGTAGG + Intergenic
1178028704 21:28499006-28499028 CATGATGAGATTGGCTGGGTTGG + Intergenic
1179882973 21:44300994-44301016 CCAGAAGTGAGGTGCTGGGTTGG + Intronic
1179939915 21:44630607-44630629 CAGGAAGTGAAGGGGAGGGCAGG + Intronic
1179939921 21:44630626-44630648 CAGGAAGTGAAGGGGAGGGCAGG + Intronic
1180721345 22:17910994-17911016 GAGGAAGTGAGGAGCCGGGTTGG + Intronic
1180765447 22:18343713-18343735 CAAGAGATGATGGCCTGGGTGGG - Intergenic
1180780867 22:18518679-18518701 CAAGAGATGATGGCCTGGGTGGG + Intergenic
1180813583 22:18775986-18776008 CAAGAGATGATGGCCTGGGTGGG + Intergenic
1180982563 22:19885678-19885700 CAGGAAGTGCTGGGCCTGGTGGG - Intronic
1181199767 22:21210316-21210338 CAAGAGATGATGGCCTGGGTGGG + Intronic
1181399996 22:22645542-22645564 CAAGAGATGATGGCCTGGGTGGG - Intronic
1181467986 22:23120550-23120572 CAGGAGGTGATGGGCTAAGCTGG + Intronic
1181572268 22:23773969-23773991 CAGAAAGGGATGGGATGGGTGGG + Intronic
1181649368 22:24250248-24250270 CAAGAGATGATGGCCTGGGTGGG + Intergenic
1181701971 22:24626640-24626662 CAAGAGATGATGGCCTGGGTGGG - Intronic
1182423086 22:30257926-30257948 CAGGGAGTGGTGGCCTGGGAGGG - Intergenic
1182436267 22:30332453-30332475 CAGGAAGGGATGAGCTGCTTTGG + Exonic
1182619987 22:31613653-31613675 CAGAAAGTGCTGGGCCGGGGCGG + Exonic
1183321456 22:37167422-37167444 CAGGAAATGTTGGGTGGGGTCGG - Intronic
1183347602 22:37316559-37316581 CAGGCAGTGGAGGGCTGGGCTGG + Intergenic
1183589006 22:38769251-38769273 CAGGAGGTGAGGGCCTGGGTCGG - Intronic
1183768976 22:39907205-39907227 CTGGCAGTGGTGGGGTGGGTGGG + Intronic
1183811348 22:40260409-40260431 CAGGAAGTCATGGCCTGGTGAGG + Intronic
1183981269 22:41541919-41541941 CAGAAGGTGATGGGCTGAGAAGG - Intronic
1184203552 22:42985881-42985903 CAGCAAGGGGTGGGCAGGGTGGG - Intronic
1184875610 22:47273641-47273663 ACGTAAATGATGGGCTGGGTGGG + Intergenic
1185213864 22:49587481-49587503 CGGGAGGTGAGGGGCTGGCTGGG - Intronic
1203227068 22_KI270731v1_random:84603-84625 CAAGAGATGATGGCCTGGGTGGG - Intergenic
1203263683 22_KI270734v1_random:1668-1690 CAAGAGATGATGGCCTGGGTGGG + Intergenic
950154077 3:10708881-10708903 CAGGAAGTGAGGAGATGGGGAGG + Intergenic
950445649 3:13036000-13036022 AAGGGAGTGAGTGGCTGGGTGGG + Intronic
950520533 3:13495274-13495296 TGGGAGGTGAAGGGCTGGGTTGG - Intronic
950617679 3:14175115-14175137 CAGCGAGCGAGGGGCTGGGTAGG - Intronic
952215347 3:31272543-31272565 CTGGAAGAGATGGGGTTGGTGGG - Intergenic
952254099 3:31680698-31680720 CAGGAAGTGAGTGGCAAGGTTGG - Intronic
953492004 3:43360532-43360554 CAGAAAGGGATGGGCAGGGCAGG + Intronic
954467217 3:50662748-50662770 CTGGAAGTCAGGGCCTGGGTTGG + Intergenic
954678070 3:52326568-52326590 CAGGAAGTGGTGTGGTGGCTGGG - Intronic
954705651 3:52479251-52479273 CAGGCAGTGGGGGGTTGGGTAGG - Intronic
955569575 3:60290261-60290283 CAGGAGGTGGTGGGCTGATTAGG - Intronic
955806471 3:62740738-62740760 CAGTAAATGATAGCCTGGGTTGG - Intronic
956700177 3:71951935-71951957 CAGAAAGAGATGGCTTGGGTTGG - Intergenic
957611446 3:82472436-82472458 GAGGAAGTTAGGGGCTGGTTAGG + Intergenic
958896626 3:99836763-99836785 CAGGGAGTGATTGGCTTGCTAGG + Intronic
959515961 3:107267367-107267389 CAGAAAGTCAAGGGCTGGCTGGG + Intergenic
960162423 3:114365113-114365135 AAGGAAGTATTGGGGTGGGTAGG - Intronic
960461790 3:117944448-117944470 CAGGAAGTGATGGGATTAGGAGG + Intergenic
960524681 3:118695860-118695882 CAGGCAGGGATGGGCTGCTTGGG - Intergenic
962264199 3:133934133-133934155 CAGGAAGTGAGGGTCTGAGGGGG + Exonic
963274091 3:143313507-143313529 CAGGAGGTGATGGGATTGGGTGG - Intronic
963607116 3:147421110-147421132 GAGGAAGGGAGGGGCTGGGGCGG + Intronic
966863883 3:184245666-184245688 GAGGATGTGAGGGGCTGGTTAGG - Intronic
967069399 3:185949620-185949642 CAGGAAGGGTTGGGCTGACTGGG - Intergenic
967087978 3:186110962-186110984 CAGGATGTCATGGGATGGGATGG - Intronic
967444415 3:189548683-189548705 CAGGAAGAGGTTGGCTGGTTAGG + Intergenic
967870231 3:194223695-194223717 CTGGAAGTGGCGGGCGGGGTGGG - Intergenic
968285001 3:197503322-197503344 CAGGAAGCCAGGGCCTGGGTAGG + Intergenic
968699172 4:2046752-2046774 CAGGAAGGGAGGGGCTGCGGGGG - Intergenic
968759543 4:2435002-2435024 AAGCAACTGAAGGGCTGGGTGGG + Intronic
969169573 4:5348987-5349009 GTGGCAGTGATGGGCTGGGCAGG - Intronic
969497928 4:7536642-7536664 AAGGATGTGATGGGCTGGGCTGG + Intronic
969641653 4:8402291-8402313 CAGGAAGTGAAGGGCAGCGGGGG + Intronic
970770640 4:19608023-19608045 CAGGAAACTATGAGCTGGGTAGG - Intergenic
971177096 4:24292528-24292550 CAGGAAGGGGTGGGGTGGGGGGG - Intergenic
971257009 4:25023647-25023669 CTGGAAGTGTTGGGCAGGGATGG - Intronic
972924597 4:43987680-43987702 AAGGGATTGATAGGCTGGGTCGG + Intergenic
972928403 4:44040568-44040590 CTGGAAGTGATGGCCTGGAATGG - Intergenic
973566128 4:52189525-52189547 CAGAAACTCATGGGCTGGGCAGG - Intergenic
975656960 4:76651133-76651155 AGGGTAGTGGTGGGCTGGGTGGG + Intronic
976217971 4:82732528-82732550 CAGGATCTGATGTGATGGGTAGG - Intronic
976938342 4:90667485-90667507 CAGGGAGTGGGGGGCTGGGGAGG - Intronic
978110947 4:104963611-104963633 GTGGTGGTGATGGGCTGGGTGGG + Intergenic
980907660 4:138963680-138963702 GAGGAAATGATGGGATGGGAGGG + Intergenic
981778685 4:148400247-148400269 CATGAAGTGGGGAGCTGGGTTGG + Intronic
982302943 4:153898799-153898821 GTGGAAGTTATGGGCTGGGTGGG - Intergenic
984086917 4:175325043-175325065 TAGGCAGAGATGGGCAGGGTAGG + Intergenic
984595851 4:181667288-181667310 CTGGAAGTGATGTGCAGGATGGG - Intergenic
985318556 4:188683888-188683910 CTGGAAGTGAAGGTCTGAGTGGG - Intergenic
985524036 5:392662-392684 CAGGAAGTGATGTGGCGGGAAGG + Intronic
985891790 5:2721607-2721629 CAGGAAGAAAGGGGCTGGGCAGG + Intergenic
986065001 5:4226804-4226826 CAGGAAGTGATGAGTAGGGAAGG + Intergenic
986718284 5:10539598-10539620 CAGGAAGGGAAGGACTGGGCTGG + Intergenic
987673402 5:21044239-21044261 CAGAAAGTGATGGAGTGGGCAGG + Intergenic
990237095 5:53780057-53780079 CAGGAAGTGTTTGGATGGATTGG - Intergenic
990694936 5:58405684-58405706 CAGGAAGGGATCGTCTAGGTGGG - Intergenic
991017321 5:61945966-61945988 GAGGAAGAGAGGGGCTGGGGAGG + Intergenic
993861832 5:93145541-93145563 CAGTAAGTGATAGGATGAGTAGG - Intergenic
994180886 5:96764963-96764985 CACCAAGAGATGGGCAGGGTTGG + Intronic
994840831 5:104923227-104923249 GAGGAATTGCTGGTCTGGGTGGG + Intergenic
996404953 5:123095336-123095358 AAGGGAGCGATGGGCGGGGTGGG - Intronic
997428215 5:133818877-133818899 TTGGAAGAGAAGGGCTGGGTGGG - Intergenic
997796963 5:136820038-136820060 CAGGTGGTGATGGGAAGGGTGGG + Intergenic
998109283 5:139488566-139488588 CCGGAAGTGCTGGTCTGGGCTGG + Intergenic
998112583 5:139513669-139513691 TGAGAAGTGATGGGCTGGGATGG - Intergenic
998352957 5:141513020-141513042 CATGAAGTGATGAGCTGAGGTGG + Intergenic
999932294 5:156446686-156446708 CAAGAAAAGGTGGGCTGGGTAGG + Intronic
1001269706 5:170302150-170302172 CTGGACGTGATGGGTGGGGTGGG - Intergenic
1001453715 5:171845358-171845380 CAGGAAGTGAAAGGCAGGGGTGG - Intergenic
1001490984 5:172155099-172155121 CAGAAAGTGGGTGGCTGGGTGGG + Intronic
1001634079 5:173197301-173197323 CAGGGACTGCTGGGCTGGGCTGG + Intergenic
1001682758 5:173570780-173570802 CTGGAGGTGAAGGGCTGGGGCGG + Intergenic
1002425004 5:179169660-179169682 CAGGAAGTGAAGGTCTGGGGAGG - Intronic
1002610407 5:180414044-180414066 CAGGAAGTTTTGGGGTTGGTGGG + Intergenic
1002791464 6:440768-440790 TAGGAAGGGATGGGATGGGATGG - Intergenic
1004112112 6:12729109-12729131 AAAGAAGTGATGGGGCGGGTGGG - Intronic
1004705564 6:18121406-18121428 CTGGGGGTGATGGGCTGGGGTGG - Exonic
1005288037 6:24349986-24350008 CAGGAAGTAATGGGGTGGAGGGG - Intronic
1005741352 6:28793755-28793777 CAGGAAGTGAAGGGAAGGGAAGG + Intergenic
1006112029 6:31753278-31753300 CTGGAAGTGAGGGTTTGGGTGGG - Intronic
1006115907 6:31776126-31776148 CAGGAAGTCCTGGGCTGCATTGG + Exonic
1006151752 6:31993617-31993639 AACGAGGTGAGGGGCTGGGTGGG + Exonic
1006158053 6:32026355-32026377 AACGAGGTGAGGGGCTGGGTGGG + Exonic
1006294617 6:33164621-33164643 AAAGAAGTGAGGGGCTGAGTGGG + Intronic
1006426142 6:33964022-33964044 GAGGAAGTGAGGGGCTGGGAGGG + Intergenic
1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG + Intronic
1006456854 6:34136925-34136947 CAGGGTGTGGTGGGGTGGGTTGG + Intronic
1007173096 6:39878308-39878330 CATGGAGTTATGGGCTGGGCAGG - Intronic
1007210407 6:40189340-40189362 CAGGATGGGGTGGGCAGGGTGGG + Intergenic
1007475389 6:42116419-42116441 CAGGAAGTGATGGGCAGAACTGG - Intronic
1007622572 6:43223961-43223983 CATGAAGTGCTGTGCTGGGAGGG + Intronic
1008531386 6:52463777-52463799 CAGGAAGTGATGGGCAATGAGGG - Intronic
1008544662 6:52574571-52574593 GAAGAAGTGATGGGCTTGGCAGG + Intronic
1010165194 6:72906524-72906546 CAGGCAGTGATGGCCTGCTTGGG + Intronic
1010250151 6:73698700-73698722 CAGGAAGAGATGGTGTGTGTAGG + Intronic
1010566587 6:77422764-77422786 CAGGAAGTGATAGTCTCAGTAGG + Intergenic
1012806703 6:103903752-103903774 CAGGAAGGAATGGGCTGCCTAGG + Intergenic
1015268696 6:131316776-131316798 CAGAGACTGAGGGGCTGGGTTGG + Intergenic
1015794998 6:137002560-137002582 CGAGAAGTGATTCGCTGGGTGGG + Intronic
1016738263 6:147503881-147503903 CTGGGAGTGAGGTGCTGGGTTGG - Intergenic
1017339378 6:153302492-153302514 TGGGAAGTGAAGTGCTGGGTAGG - Intergenic
1018012683 6:159686014-159686036 CAGGAAGAGCTGGGCTGCCTTGG - Intronic
1018241906 6:161785114-161785136 CAGGCAGTGATTAGCTGGGTAGG + Intronic
1018988099 6:168653162-168653184 CAAGAACTGATGGGCTGCCTGGG + Exonic
1019347593 7:538482-538504 CAGGAAGTGAAGGGCTGGCATGG - Intergenic
1019702418 7:2480367-2480389 CAGGAGGTGAGGGGCTTGCTGGG + Intergenic
1020244763 7:6421835-6421857 CAGCCTGTGATGGGCAGGGTGGG + Intronic
1022729301 7:33007488-33007510 GAGGTAGGGATGGGGTGGGTGGG + Intergenic
1023438779 7:40165621-40165643 AAAGAACTGATGGGCTGGGTGGG - Intronic
1023627359 7:42129512-42129534 TAAGAAGCCATGGGCTGGGTTGG + Intronic
1024121099 7:46241315-46241337 CAGGAGGGAATGGGCTGGGAGGG + Intergenic
1024436256 7:49358779-49358801 CAAGAAGTGATTGGCCGGTTGGG + Intergenic
1024637766 7:51304351-51304373 GAGGAAGTCATGGGCTGGACAGG - Intronic
1025044351 7:55680492-55680514 GAGGTAGGGATGGGGTGGGTGGG - Intergenic
1026672455 7:72402001-72402023 CTGGAAGGGATGAGCTGGGATGG + Intronic
1026775260 7:73227226-73227248 CAGGAAGTGATGGGGGCGGGCGG - Intergenic
1027016117 7:74780597-74780619 CAGGAAGTGATGGGGGCGGGCGG - Intronic
1027071911 7:75165340-75165362 CAGGAAGTGATGGGGGCGGGCGG + Intergenic
1028519012 7:91708080-91708102 GTGGCAGTGGTGGGCTGGGTGGG - Intronic
1028581890 7:92417402-92417424 CAGGGAGTGAGTGGCTGGGGTGG - Intergenic
1028915190 7:96251269-96251291 GATGAAGTGAGGGGCTGGGGAGG + Intronic
1029714365 7:102317908-102317930 GAGGAGGAGCTGGGCTGGGTGGG + Intronic
1030372044 7:108711659-108711681 CAGGAAATGATTGGCTGGGCAGG - Intergenic
1032262067 7:130346286-130346308 CAGGAGAGGATGTGCTGGGTTGG + Intronic
1032383888 7:131508277-131508299 GAGGAGCTGATGGGATGGGTGGG - Intronic
1032891456 7:136199539-136199561 CAGGCTGTGGTGGGCTGGCTTGG + Intergenic
1033021035 7:137724460-137724482 CAGAAAGTGATGGCTTGGATTGG + Intronic
1034980330 7:155471686-155471708 GGGGAAGGGATGGGGTGGGTTGG - Intergenic
1035033283 7:155878456-155878478 CAGGAGGTGAGGGGCAGGGGTGG + Intergenic
1035056675 7:156040595-156040617 CAGGAAGGGAGGAGCTGGGCTGG - Intergenic
1035761280 8:2070565-2070587 CAGGCACTGATGAGCTGGGCAGG + Intronic
1036406682 8:8461496-8461518 CAGGGAGGGAGGGGCTGGGAAGG + Intergenic
1036924988 8:12895827-12895849 CAGCAAGTGAGTGGCAGGGTTGG - Intergenic
1037655259 8:20877629-20877651 CAGTCTGTGGTGGGCTGGGTTGG + Intergenic
1038145143 8:24888400-24888422 CAGCAGGTGATGGGCTGGCCAGG + Intergenic
1038924700 8:32125688-32125710 GAGGTAGTGATGGAGTGGGTGGG - Intronic
1039948785 8:42152414-42152436 CGGGGAGTGAGGGGCTGGGCGGG - Intergenic
1040079652 8:43274437-43274459 CAGGGAGGGATGGGCTAGCTGGG - Intergenic
1040567333 8:48579452-48579474 CAGGAAAGGATGGGATGGCTGGG + Intergenic
1040876571 8:52158725-52158747 CAGGCAGGGATGAGCTTGGTGGG - Intronic
1042286365 8:67116030-67116052 GATGAACTGATGGGATGGGTGGG - Exonic
1042366965 8:67948183-67948205 TAGGAAGTGATGGGGAGGGAAGG + Intergenic
1042932676 8:74029309-74029331 CAGGAAGCAATGGGCAAGGTAGG + Intergenic
1043908314 8:85833042-85833064 CGGGAAGGGATGGGATGGGAGGG - Intergenic
1045803459 8:106128424-106128446 CAGGAGGTGATGGCTGGGGTAGG + Intergenic
1046618946 8:116507306-116507328 AAGGAAGATAAGGGCTGGGTAGG + Intergenic
1047611167 8:126522240-126522262 CAGGAACTGAAGGGCTGGAGAGG + Intergenic
1048268742 8:133011104-133011126 AAGGAAGTGAGGGGCAGGATTGG + Intronic
1048385538 8:133909223-133909245 CATGCAGGGATGGGCTGGGGAGG + Intergenic
1048508212 8:135039872-135039894 CAGAAAATGATGGGCAGAGTTGG - Intergenic
1049034006 8:140060588-140060610 CAGGTAGGGATGGGTAGGGTTGG - Intronic
1049690738 8:143957810-143957832 CAGGGGGTTAGGGGCTGGGTGGG - Intronic
1049692202 8:143966347-143966369 CAGGAAATGCTGGGCTGAGGTGG - Intronic
1049772624 8:144390781-144390803 CATGAGGTGGTGGGCTGGGTGGG + Intronic
1049844941 8:144795669-144795691 CAGGAAGAGGTGGGGTGGTTGGG + Intergenic
1050254358 9:3778668-3778690 CAGGAAGGGCTAGTCTGGGTTGG + Intergenic
1050693493 9:8254545-8254567 CAGAAAGTGATGGTTTCGGTAGG + Intergenic
1050908848 9:11040560-11040582 CAGGAAGTGAGTGGCTGGTGAGG + Intergenic
1052917110 9:33931839-33931861 CAGGAGGTGTTGGGCGAGGTTGG - Intronic
1054816779 9:69483287-69483309 CAGGAAGTGTGGGGATGCGTGGG + Intronic
1054834413 9:69661402-69661424 CAGGAAGAGATGGGAAGGGCAGG + Intronic
1056013785 9:82360556-82360578 CAGGATGAGATGGGGTGGGAAGG - Intergenic
1056038788 9:82637841-82637863 GTGGCTGTGATGGGCTGGGTGGG - Intergenic
1056526400 9:87446872-87446894 CAGCAACTGAGGGGCAGGGTGGG - Intergenic
1056811854 9:89771254-89771276 CTGAACGTGGTGGGCTGGGTGGG + Intergenic
1057265659 9:93615884-93615906 CAGGAAGAGATGAGCTGGGAAGG + Intronic
1057479331 9:95432263-95432285 CAGGTGGTGATGGGCGGGGGTGG + Intergenic
1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG + Exonic
1059465351 9:114465946-114465968 GAGAAAGTGATAAGCTGGGTTGG - Intronic
1059986923 9:119829465-119829487 CAGGCAGTGATGGGCTTCTTGGG - Intergenic
1060596441 9:124851906-124851928 CTGGGAGTGAAGGGCTGGGCTGG + Intergenic
1060943784 9:127558126-127558148 CAGACAGTGAGGGGCTGTGTTGG - Intronic
1061315777 9:129795002-129795024 CAGGCAGGGATGGGATGGGGAGG + Intergenic
1061507418 9:131039326-131039348 CAGGAAGGGATGGGGAGGGGAGG - Intronic
1061519601 9:131110316-131110338 CAGGACCAGATGGGCAGGGTGGG - Intronic
1062096254 9:134705482-134705504 GAGGAAGTGATGGGCATGGAGGG + Intronic
1062195782 9:135273217-135273239 CAGGAAGTGCAGGGCTGGGGAGG + Intergenic
1062634025 9:137480590-137480612 CAGGAAGTGCTGGGCAGGGAGGG - Intronic
1186568516 X:10690040-10690062 CAGGAAATGAGGGGCAGGGTGGG + Intronic
1187326564 X:18295599-18295621 GTGGCAGTGGTGGGCTGGGTGGG - Intronic
1187423862 X:19160101-19160123 CAGGTAATGAGGGGCTGGGAAGG + Intergenic
1187680417 X:21761619-21761641 AAGGTAGTTATGGGCTGGTTCGG + Intergenic
1188060012 X:25590083-25590105 GTGGCTGTGATGGGCTGGGTGGG + Intergenic
1190431094 X:50378558-50378580 CAGGTAGGCAGGGGCTGGGTGGG - Exonic
1190900181 X:54664681-54664703 CAGGAAATAATGGGAAGGGTGGG - Intergenic
1192268276 X:69555498-69555520 CAGCAACTGAGAGGCTGGGTGGG + Intergenic
1193076928 X:77364550-77364572 CAGGAAGGAATGGGCTGCCTGGG - Intergenic
1194097896 X:89665993-89666015 CAGGCTGTGATGAGCAGGGTGGG + Intergenic
1195298189 X:103500715-103500737 CAGGAAGTCATAGGCCTGGTCGG + Exonic
1196746667 X:119077217-119077239 CAGCAAGGGATGGGCTGGGGAGG + Intergenic
1196844513 X:119887868-119887890 CAGGAGCCGATGGGCGGGGTCGG - Intergenic
1196950476 X:120871474-120871496 CAGCAAGGGCTGGGCTGGGGAGG - Intergenic
1197026061 X:121750916-121750938 AAGGAAGGGAAGGGCTGAGTAGG + Intergenic
1197116899 X:122844237-122844259 CAAGGAATGATGGGCTTGGTTGG + Intergenic
1197777543 X:130129044-130129066 CAGGAAGTCATGGGCTAGCAGGG + Intergenic
1198042991 X:132872994-132873016 CAGGAAGTGATGGGCTGGGTTGG - Intronic
1200009094 X:153108104-153108126 CAGGAGGAGTTTGGCTGGGTTGG - Intergenic
1200030506 X:153291818-153291840 CAGGAGGAGTTTGGCTGGGTTGG + Intergenic
1200450918 Y:3327382-3327404 CAGGCTGTGATGAGCAGGGTGGG + Intergenic
1201616640 Y:15907906-15907928 CAGGAAGTAAGTGGGTGGGTGGG + Intergenic
1201860001 Y:18586384-18586406 CAGGAAGACAAGGGCTTGGTTGG + Intronic
1201873320 Y:18733997-18734019 CAGGAAGACAAGGGCTTGGTTGG - Intronic