ID: 1198047025

View in Genome Browser
Species Human (GRCh38)
Location X:132913365-132913387
Sequence CTGTTTGCTCAGGCTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198047025 Original CRISPR CTGTTTGCTCAGGCTGTGGA TGG Intronic
901552665 1:10007380-10007402 CTTTTTAATCAGGCTGTGGTTGG + Intronic
902332025 1:15735411-15735433 GTGTCTGCTCAGGCTGGGGCCGG - Intergenic
902371804 1:16012379-16012401 CTTTGTGCTCTGGCTCTGGAGGG + Intergenic
903173448 1:21567448-21567470 CTGTTTGCCCAGGCTGCGGTGGG + Intronic
903284499 1:22268395-22268417 GAGGTTGCTGAGGCTGTGGATGG + Intergenic
904471550 1:30739707-30739729 CCCTGTGCTCAGGCTGGGGAGGG - Intronic
904958255 1:34306784-34306806 CTGTGTGCTCTAGCTCTGGAGGG - Intergenic
904958396 1:34308684-34308706 CTGTGTGCTCAGAGTGTGGTTGG - Intergenic
905287417 1:36890575-36890597 CTGGTGGCTCAGTATGTGGAGGG + Intronic
905760733 1:40555005-40555027 CTTTTTTCCTAGGCTGTGGATGG - Intergenic
906112970 1:43336927-43336949 CTGTTTGCTCAGATTGGAGATGG - Intergenic
907079830 1:51610948-51610970 ATGTTTGTTCAGGGTGTAGATGG + Intronic
907291152 1:53413832-53413854 CTGTGTGCTCAGGAGGTGGGAGG - Intergenic
907660312 1:56385967-56385989 CTGTTTGTTTAGGCTGGGGGTGG + Intergenic
907807431 1:57835650-57835672 TTGTTTGCACAGGCTGTAGCTGG - Intronic
908394620 1:63714080-63714102 CTGTGTCCTCAGGGTGTGGCTGG + Intergenic
909189867 1:72538538-72538560 TTGTTTATTCAGGGTGTGGATGG + Intergenic
910789993 1:91041342-91041364 CTATTTCCTCAGGCAGTGCAAGG - Intergenic
912518405 1:110229793-110229815 CTTGTTCCTCAGGCTGTGGAGGG - Intronic
913610629 1:120506500-120506522 CTCTTTGCTGAGGCTGGGGAAGG + Intergenic
913984167 1:143550313-143550335 CTCTTTGCTGAGGCTGGGGAAGG - Intergenic
914580561 1:149015739-149015761 CTCTTTGCTGAGGCTGGGGAAGG - Intronic
916046120 1:161000976-161000998 CTGATTGCCTAGGTTGTGGAGGG - Intronic
918246161 1:182661315-182661337 CTGTTTGCACAGGGCATGGAGGG - Intronic
918773413 1:188594802-188594824 TTCTTTGTTGAGGCTGTGGAAGG + Intergenic
919503895 1:198373569-198373591 CTGTTAGCTCAGCCTCTGCAGGG - Intergenic
922558088 1:226548545-226548567 CTGTTTGCCCAGGTGCTGGAAGG - Intergenic
922623077 1:227006353-227006375 CTGTGAGCACAGGCTATGGAGGG + Intronic
923059557 1:230458136-230458158 CTGTTTTCTGAGGCTGGGCACGG - Intergenic
923116389 1:230942831-230942853 GTGTTTGCTGAGGCTGTCGGAGG - Intronic
923503853 1:234589120-234589142 GTGTCTGCTCAGACAGTGGATGG + Intergenic
1063221268 10:3970595-3970617 CTGATTGCTCAGGTTGGAGATGG - Intergenic
1063319197 10:5036898-5036920 CTTTTAGCTCAGGCTATGGCTGG + Intronic
1064820100 10:19319686-19319708 CTGTTTCCTCACGCGGTAGAAGG + Intronic
1065679579 10:28215090-28215112 CTGATTGTTCAGGCTGGAGATGG - Intronic
1065961078 10:30734839-30734861 ATTTTTTCTCAGGGTGTGGAAGG + Intergenic
1066167362 10:32801757-32801779 CTGTTACCTCAGGCAGTGCAGGG + Intronic
1067692759 10:48512702-48512724 CTGTTTGTGCAGCCTTTGGATGG - Intronic
1068296617 10:55079865-55079887 AGGTTTGCTCAGGCTCTGGTGGG + Intronic
1068775502 10:60864000-60864022 CTAAGTGCTCAGGCAGTGGAGGG - Intergenic
1070305804 10:75238512-75238534 CTGTATGCTCAGGCCTGGGAAGG - Intergenic
1070404096 10:76079298-76079320 CCGTTTGATCTGACTGTGGAGGG + Intronic
1071191769 10:83109237-83109259 GTGATTGCTCAGGGTGGGGAAGG - Intergenic
1071454731 10:85837200-85837222 GTGATTGCTCAGGTTGTGGGAGG - Intronic
1071513742 10:86283284-86283306 CTATTTGCACAGGTTGGGGAGGG + Intronic
1072823000 10:98576748-98576770 CTGTTTTCTCAGACTGTGTTGGG - Intronic
1075158640 10:120003028-120003050 CTGGCTGCTCAAGCTGTGAAAGG + Intergenic
1077273087 11:1690943-1690965 GTCTGTGCTCAGGCTGTGGGAGG + Intergenic
1077280959 11:1745239-1745261 CGCTTGGCTCAGGCTGTGGCTGG - Intronic
1077354495 11:2108930-2108952 CTCTTGGCCCAGGCTGGGGATGG - Intergenic
1079093133 11:17494538-17494560 CTGTGTGCTGTGGCTGTGGCTGG - Intronic
1080844565 11:36015396-36015418 CTGGTTGCTCAGGCTGTAGAAGG + Intronic
1081026367 11:38019648-38019670 GTGATTGCTCAGGGTGTGGGAGG - Intergenic
1083401855 11:62428934-62428956 CTGATTGGTCAGGCTGGAGATGG + Intergenic
1083455807 11:62777966-62777988 CTTTTTCCTCAGGCTGTGTGTGG + Exonic
1083894725 11:65614132-65614154 CTTTTTGCGCAGGGGGTGGAGGG + Exonic
1084405861 11:68972770-68972792 CTGATTGGTCAGGCTGGAGATGG + Intergenic
1084970330 11:72768063-72768085 CTGTGCACTCACGCTGTGGAGGG - Intronic
1085117778 11:73945403-73945425 CTTTTAGCTCAGGCTATGGCTGG - Intergenic
1085685623 11:78619680-78619702 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
1085849204 11:80099946-80099968 TTGTTTTCTCAGGGTGAGGAAGG + Intergenic
1086278295 11:85157950-85157972 CTGTTTTCTCAGGCAGTGCGGGG - Intronic
1087886953 11:103492957-103492979 CTGTTTGATCAGGTTGAAGATGG + Intergenic
1088407943 11:109501189-109501211 CTGTTACCTCAGGCAGTGCAGGG + Intergenic
1088449015 11:109962829-109962851 CTGTTGGCTCAGTCAGTGCAGGG - Intergenic
1089397881 11:118147693-118147715 CTGTTTGTGGGGGCTGTGGAGGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091276890 11:134358800-134358822 CTGGTTGCTCCGGATCTGGAAGG - Intronic
1092476190 12:8820966-8820988 CTGATTGCTCAGGTTGGAGATGG - Intergenic
1093160525 12:15741336-15741358 CTGCTGGCTCAGGATGGGGATGG - Intronic
1095603748 12:44043581-44043603 CTGTTGTCTCAGGCAGTGCAAGG - Intronic
1096370800 12:51067512-51067534 CTGTTTGCTTACTCTGTTGACGG + Intronic
1097803185 12:63937875-63937897 CTGTTTCCACATGCTGTGAAGGG - Intronic
1097905908 12:64919569-64919591 CTGTGTGCTCACACGGTGGAAGG + Intergenic
1099375318 12:81891454-81891476 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
1101691562 12:107087239-107087261 CAGTGTGCTCAGGATGTGGGAGG + Intronic
1102736067 12:115160892-115160914 CTGTCTGCTAATGATGTGGATGG - Intergenic
1103272367 12:119684071-119684093 CTGTTTCCTGAAGCTGGGGAGGG - Intergenic
1103735053 12:123055794-123055816 CTGTTTGCTTCTGCTGGGGAAGG - Intronic
1104133618 12:125917454-125917476 CTGTGTGATCAGGTTCTGGAAGG - Intergenic
1105040128 12:132955342-132955364 GTGTTGGCTCAGGCTGGGGATGG + Intronic
1106232118 13:27828566-27828588 CTGCTTGCTGAGGGTGTGGCAGG - Intergenic
1107164729 13:37271028-37271050 CTGTTTCCTCAGGCTCTGAGTGG - Intergenic
1107364813 13:39658701-39658723 TTGTTTGCTCTGTCTGTGGAAGG + Intronic
1108134402 13:47339625-47339647 CTGATTGGTCAGGTTGTAGATGG - Intergenic
1109158039 13:58935914-58935936 CTCTGTGCTCAGCCTGTGGCTGG + Intergenic
1109515958 13:63442793-63442815 CTGTTGCCTCAGGCAGTGCAAGG - Intergenic
1109713005 13:66183499-66183521 CTGTTGACTCAGGCAGTGCATGG + Intergenic
1110803070 13:79723215-79723237 CTGTTTCTTCAGGCAGTGGCAGG + Intergenic
1111277278 13:85966816-85966838 CTCTGTGCTCAGCCTGTGGCTGG + Intergenic
1111458068 13:88509097-88509119 CAGTTTCCTGAGGCTGTGCAGGG + Intergenic
1112764259 13:102724001-102724023 CTGTGTGCTCACACGGTGGAAGG - Intergenic
1112798374 13:103082915-103082937 CTTTATGCTCAGGCTGATGATGG + Intergenic
1113207738 13:107936856-107936878 CTTTTGGCTAAGGCTGAGGAGGG - Intergenic
1114659280 14:24334575-24334597 CTGCTGGCTCAGGCTGTAGTAGG + Exonic
1114783378 14:25565521-25565543 CTGTTTGCTCAGGATGGGTTTGG + Intergenic
1115913540 14:38283640-38283662 CTGTGTCCTCAGGTGGTGGAAGG - Intergenic
1117563277 14:56967702-56967724 GTGTTTACCCAGGATGTGGATGG + Intergenic
1117876837 14:60261194-60261216 GAGATTGCTCAGGCTGAGGAGGG + Intronic
1118198224 14:63648105-63648127 CTGATTGGTCAGGTTGGGGATGG + Intergenic
1120231734 14:81847771-81847793 CTGTTGCCTCAGGCAGTGCATGG + Intergenic
1121818029 14:96943291-96943313 CAGCTTGCCCAGGCTGTGCATGG + Intergenic
1122768026 14:104085130-104085152 CTCTGTGCTCAGGTCGTGGAGGG + Intergenic
1122951743 14:105048764-105048786 CTGTTTACTCAGGCTGGGCGCGG - Intergenic
1124353870 15:28980223-28980245 CTGATTGCTCTGGCTCAGGAAGG - Intronic
1125000133 15:34760907-34760929 CTTTTTCCTCATGCTGGGGATGG + Intergenic
1126304742 15:47242639-47242661 CAGTTTGCTCAGGGGGTTGAAGG + Intronic
1127314618 15:57783110-57783132 TTGTTTCCCCAGGGTGTGGATGG + Intergenic
1127768941 15:62214929-62214951 CTTTTAGCTCAGGCTATGGCTGG - Intergenic
1127825558 15:62699658-62699680 CTGTTTGAGTAGGCTGGGGAAGG - Intronic
1128358047 15:66942210-66942232 CTGTTTGGTGAGGCTGAGGTAGG + Intergenic
1129857136 15:78832395-78832417 CTGTTTGCGAAGGCTGTGCTAGG - Intronic
1130537751 15:84799144-84799166 GTGTTTGCGCAGGCTGTTGGGGG - Exonic
1131998717 15:98158641-98158663 CTGTTTGCTCACGCTGTACTTGG - Intergenic
1132559661 16:587590-587612 CTGTGTCCACAGGCTGTGGTGGG + Intergenic
1132794226 16:1711228-1711250 CTGCTTTCTCTGGCTGTGTAAGG + Intronic
1133103862 16:3494626-3494648 CTGTGCCCTCAGGCTGTGGCAGG + Exonic
1133287536 16:4697590-4697612 GTGTTTGCTCAGCCTGTGGGAGG - Intronic
1135238381 16:20780053-20780075 ATGTTTGCTGAGGCTGGGCATGG - Intronic
1135845327 16:25913378-25913400 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1136401852 16:30023607-30023629 CTTATTGCAGAGGCTGTGGAGGG - Intronic
1136656968 16:31715143-31715165 ATGTTGACTCAGGCTGTGGGTGG + Intronic
1137329259 16:47474366-47474388 CTTATTGCTAAAGCTGTGGATGG + Intronic
1138006504 16:53342553-53342575 CTGATTGGTCAGGCTGGAGATGG - Intergenic
1138459417 16:57139179-57139201 CTGATTGGTCAGGCTGGAGATGG + Intronic
1138593846 16:58018799-58018821 CTGTTTTGTCTGTCTGTGGAGGG + Intronic
1140453443 16:75090050-75090072 CTGCAGGCTGAGGCTGTGGAAGG - Intronic
1140516558 16:75547036-75547058 CTGTTTGGCAAGACTGTGGATGG - Intronic
1141220353 16:82063787-82063809 CTGCTGGCTCAGGCTGAGGGTGG + Intronic
1141695778 16:85618563-85618585 CTGTATCCTGAGGCTGTTGAGGG + Intronic
1142401976 16:89863688-89863710 CTGTTTGCTCATGATCTGGTTGG + Intronic
1143312459 17:6003201-6003223 CTCTTTACTCAGGCTGCAGAGGG + Intronic
1144460948 17:15458197-15458219 CTGTTTCCTCTGGCTCTGGAGGG + Intronic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1144758206 17:17693044-17693066 GTTTTCGCTCAGGCTGTGTAGGG + Intronic
1145907713 17:28525361-28525383 CTGTATGCTAAGGCTGGGGAGGG - Intronic
1146246339 17:31286752-31286774 ATGGTTGCTGAGGCTTTGGATGG + Intronic
1147150684 17:38511816-38511838 CTGTGTGCCTGGGCTGTGGAAGG - Exonic
1147656875 17:42096179-42096201 CTATTTGCAGGGGCTGTGGATGG - Intergenic
1148793550 17:50186731-50186753 CTGCTGGCTCAGGCTCTTGAGGG + Exonic
1149852758 17:60050206-60050228 CTGTGTCCTCAGGTGGTGGAAGG - Intronic
1150896133 17:69213233-69213255 CTGGTTTCTCAGGCTATGGGTGG + Intronic
1151588223 17:75024705-75024727 CTTTTAGCTCAGGCTATGGCTGG + Intergenic
1152117058 17:78394843-78394865 CTGTTTCTTCAGGCTGGGCACGG - Intronic
1152506370 17:80751689-80751711 TTGTTTACTCAGACTGTGGCAGG - Intronic
1152585938 17:81189477-81189499 CAGCCTGCTCAGGCTGCGGAGGG + Intergenic
1152879735 17:82808205-82808227 CTGTGGGCTCGGGCTGTGCAGGG + Intronic
1153526371 18:5998477-5998499 CTGCTTGCTCAGGCTGAGGGTGG + Intronic
1156192372 18:34734228-34734250 CTGTTGCCTCAGGCAGTGCAGGG + Intronic
1156749972 18:40440416-40440438 CTATGTGATCAGGCTGTGGATGG - Intergenic
1157792144 18:50542196-50542218 CTGTGTGCTCATGCAGGGGAGGG - Intergenic
1158738637 18:60113404-60113426 CTGTATCCTCTGGATGTGGAAGG + Intergenic
1159287460 18:66372945-66372967 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
1159983291 18:74812389-74812411 CTGTTTTCTCTGGGTGTAGAGGG - Intronic
1160183342 18:76655117-76655139 CTGTGTTCTCACGCAGTGGAAGG + Intergenic
1160253252 18:77222687-77222709 CTGTTTGCTCATGCTAGGTAAGG - Intergenic
1161297153 19:3525946-3525968 CAGTTGGCTCCGGCTCTGGAGGG - Exonic
1161464838 19:4423282-4423304 CTCTTTGCTTTGGCTCTGGAAGG - Intronic
1161979078 19:7621158-7621180 CTGTTTGAACAGGCTCTGGACGG - Exonic
1162091133 19:8280734-8280756 CTGCTTGCTAAAGGTGTGGAGGG - Intronic
1162093367 19:8295572-8295594 CTGCTTGCTAAAGGTGTGGAGGG - Intronic
1164200394 19:23013230-23013252 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
1165081081 19:33306334-33306356 CTTCTTCCTGAGGCTGTGGATGG + Intergenic
1165735696 19:38174071-38174093 CTGTGTGCTGAGGCTGGGGAAGG + Intronic
1166573012 19:43810973-43810995 GTGTTTGATCACGCTGTGGGTGG - Intronic
1166698125 19:44865829-44865851 CTGTGTGCTGAGGATGTGGCAGG + Intronic
1167754127 19:51400564-51400586 CTTTTAGCTCAGGCTATGGCTGG - Intergenic
1168391265 19:56009819-56009841 AGCTTTGCTCAGGCTGTGGGTGG + Intronic
1168457054 19:56520688-56520710 CTGTTTCCTCACACAGTGGAAGG - Intronic
925474366 2:4196687-4196709 CGGCTTGCTAAGGCTGTGCACGG - Intergenic
925499728 2:4489434-4489456 CTGTTCCCTCAGGCAGTGCAGGG + Intergenic
925628157 2:5862682-5862704 CTCCGTGCTCAGCCTGTGGATGG - Intergenic
925699928 2:6626553-6626575 ATATTTGTTCAGGCTGTGTAGGG + Intergenic
927108522 2:19847761-19847783 TTCTTAGCTCAGGCTGTGGTGGG + Intergenic
929270171 2:39963302-39963324 CTGTTTCCTCAGGCAGCGCAGGG + Intergenic
929565563 2:42981944-42981966 CTGTGTCCTCAGACAGTGGAAGG + Intergenic
929748216 2:44681481-44681503 TTATTTGCTCAGGCAGAGGAGGG + Intronic
930587365 2:53283562-53283584 CTTTTTCCTCAGTCTATGGATGG + Intergenic
933615105 2:84475582-84475604 CTTTTAGCTCAGGCTATGGCTGG - Intergenic
933657925 2:84905018-84905040 CTCTTTGCTCAGGTTGGGGGCGG - Intronic
935108393 2:100068409-100068431 CTGTTTGTTGAGGCTGTGGTGGG + Intronic
936346026 2:111675875-111675897 CTGTGTGCTCACGTGGTGGAAGG - Intergenic
936525971 2:113241944-113241966 CAGTTTGCTCAGGCTTTGATGGG - Intronic
936947243 2:117941781-117941803 CAGTTTCCTGAGTCTGTGGAAGG - Intronic
937283645 2:120736625-120736647 CTGTTTTTTCAGGGGGTGGAGGG + Intronic
937785520 2:125890184-125890206 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
938831072 2:135050890-135050912 CTGTTTGCTCAGTTTTTGGCTGG - Intergenic
939086182 2:137721182-137721204 CTGTTGCCTCAGGCAGTGTAGGG - Intergenic
939726530 2:145727462-145727484 CTGATTGGTCAGGTTGGGGATGG - Intergenic
939862283 2:147434659-147434681 CTGTGTCCTCATGTTGTGGAAGG + Intergenic
939871738 2:147533650-147533672 CTGTGTCCTCACACTGTGGAAGG + Intergenic
940021097 2:149156556-149156578 CTGTCTGCATAGCCTGTGGATGG + Intronic
941331008 2:164177100-164177122 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
941663211 2:168216625-168216647 AGGTTTGCTCAAGCTGAGGATGG - Intronic
941904576 2:170708262-170708284 GTGCTTGCCCAGGCTGGGGAAGG - Intergenic
943006223 2:182390877-182390899 CTGTTGCCTCAGGCAGTGCATGG - Intronic
943318171 2:186414172-186414194 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
944337298 2:198550755-198550777 TCTTTTGCTGAGGCTGTGGATGG - Intronic
944865715 2:203859490-203859512 GTGTTTGCACAGTCTGTGGCAGG - Intergenic
945726498 2:213476760-213476782 CTCTTAGCTCAGGTAGTGGAAGG + Intronic
946790601 2:223297229-223297251 CTGTTGCCTCAGGCAGTGCATGG - Intergenic
947935044 2:233997453-233997475 CTCTGTGCTCCAGCTGTGGAGGG - Intronic
948298805 2:236886433-236886455 CTGTTTGCACTGACTGTGGCTGG + Intergenic
948326547 2:237126500-237126522 CTGCTTGCCCTGGCTGTGGAAGG + Intergenic
948668283 2:239549986-239550008 CTGTTTTCTATGGCCGTGGAAGG - Intergenic
948892454 2:240914101-240914123 CCCTTTGCTCAGGCTGGGAAGGG + Intergenic
1169110642 20:3031050-3031072 CTGTCTGCCCAGGCTGATGATGG - Intronic
1170178379 20:13498632-13498654 GTGTTTGTTCAGGCTGGGCATGG - Intronic
1170324238 20:15138278-15138300 CTGTTTGCTGAGGTTGAGAAAGG + Intronic
1170382759 20:15779660-15779682 CTGAATCCTTAGGCTGTGGAGGG - Intronic
1172250361 20:33475218-33475240 CTGTTTGCTCAAATTGTGCATGG - Intergenic
1173022848 20:39282647-39282669 CTGCTTGCACAGGCTGTCGAGGG + Intergenic
1173555300 20:43961505-43961527 CAGTTGGCTCAGGCAGTGCAGGG - Intronic
1173620318 20:44431254-44431276 CTGGTTTCTGAGGCTGTAGAAGG - Exonic
1174550275 20:51357060-51357082 CTGGCTGCTCAGGCTCTGGGAGG - Intergenic
1175278232 20:57786406-57786428 TTGTCTGCTCAGGGTCTGGAAGG + Intergenic
1175321118 20:58089060-58089082 CTATTTGCTCAGAGAGTGGATGG + Intergenic
1175339081 20:58216246-58216268 CATTTTGCTCAGTCTGTGGTAGG - Intergenic
1175461796 20:59157384-59157406 CTCTTTCCTCCGGCTGTGGATGG + Intergenic
1175495210 20:59409652-59409674 CTTTTTCCCCAGACTGTGGAGGG - Intergenic
1175829102 20:61952330-61952352 CTGTGTCCTCAGGCTGCTGAGGG - Intergenic
1175993744 20:62803136-62803158 CTGTTTTCTGGGGCAGTGGAGGG + Intergenic
1176292748 21:5054991-5055013 CTGGATCCTCAGGATGTGGATGG - Intergenic
1177363398 21:20103330-20103352 CTGTTGCCTCAGGCAGTGTAGGG - Intergenic
1178441129 21:32599170-32599192 GTGGTTGCTGAGGCTTTGGAAGG + Intronic
1178764159 21:35433455-35433477 CTGTTGCCTCAGGCAGTGCAGGG + Intronic
1179153867 21:38832696-38832718 CTGTTTTCTCAAGCTATGTATGG + Intergenic
1179839713 21:44063460-44063482 CTTCCTGCTCAGGCTGAGGATGG - Intronic
1179864512 21:44208659-44208681 CTGGATCCTCAGGATGTGGATGG + Intergenic
1180106196 21:45619656-45619678 CTGATTGGTCAGGCTGGAGATGG + Intergenic
1182314337 22:29434140-29434162 CTATTAGATCAGGCTGTGTACGG - Intergenic
1183437844 22:37805516-37805538 CTGTCTGGTCCGGCTGTTGAAGG - Exonic
1183773167 22:39944431-39944453 CTGTTTGTTCAGGGTGGGGTGGG - Intronic
1183831290 22:40419527-40419549 CTGTTGGCTCAGGTGGTGGGGGG - Intronic
1184058091 22:42066029-42066051 CGGCTTGCTCAGGATGAGGAGGG + Intronic
1184959223 22:47917096-47917118 GTGGGTGCTCAGGCTGTGGGGGG - Intergenic
949245536 3:1922393-1922415 CTGTTGCCTCAGGCAGTGCATGG - Intergenic
950467581 3:13164241-13164263 ATGTCTGCTGAGGCTGGGGAGGG - Intergenic
950579862 3:13855054-13855076 CTGGTTGCCCAGGATCTGGAAGG + Intronic
951419024 3:22462007-22462029 ATGTTTGCCAAGGATGTGGAAGG - Intergenic
951971083 3:28444387-28444409 CTGTTGTCTCAGGCAGTGTAGGG + Intronic
952068816 3:29607408-29607430 CTGTGTCCTCACACTGTGGAAGG + Intronic
952900772 3:38110251-38110273 CTTTTTGCTCAGGCTGTTTTGGG - Exonic
955813144 3:62812899-62812921 CTGTTTTCTGAGGCTGTGGATGG + Intronic
955892833 3:63668337-63668359 CTTTTTGCGGAGTCTGTGGATGG + Intronic
956241259 3:67133279-67133301 TTGTTTTCTAAGGATGTGGAAGG + Intergenic
957142040 3:76372836-76372858 ATGTTTGGTGAGGCTGGGGAAGG - Intronic
958928083 3:100180173-100180195 CTGTTTGGTGGGGCTGGGGAGGG + Intergenic
959227101 3:103599817-103599839 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
959516713 3:107275406-107275428 CTGTTTTCTCTTGCTATGGAAGG - Intergenic
961724913 3:128921513-128921535 CTTTTAGCTCAGGCTATGGCTGG + Intronic
961774413 3:129273964-129273986 CATTATGCTCAGCCTGTGGATGG + Intronic
962041168 3:131708664-131708686 TTCTCTGCTCAGGCTGGGGATGG + Intronic
963566534 3:146938165-146938187 CTGTTGTCTCAGGCAGTGCAGGG - Intergenic
963834933 3:150048491-150048513 CTGTGTGCCCAGGCAGTGGGTGG - Intronic
964466024 3:156994225-156994247 CTGTTTGCTGAGTCTGGGGGTGG + Intronic
965342561 3:167508095-167508117 CTCTTGGCTCTGGCTGTGGAAGG + Intronic
965692774 3:171375398-171375420 CTGTTTGCTAAGCATGTGGTGGG - Intronic
966269195 3:178084187-178084209 CTGTTTAGCCAGGCAGTGGAAGG - Intergenic
967664796 3:192158270-192158292 CTATTTCCTGAGTCTGTGGAGGG - Intronic
968058583 3:195711660-195711682 CTGCTGGCTCAGGGTGGGGAAGG - Intergenic
968222417 3:196948563-196948585 CTGGCTGCTCAGGCTCTGGGAGG - Exonic
968455403 4:695924-695946 ATGTTTGTCCAGGCTGTGCAAGG - Intergenic
968790990 4:2661740-2661762 CTGTGTGCCCAGGCTGAAGATGG + Intronic
969514551 4:7639076-7639098 CTGGGTTCTGAGGCTGTGGAGGG + Intronic
970059563 4:12016317-12016339 CTGTTTGCTGAGGTTCTTGATGG - Intergenic
971407098 4:26331834-26331856 CTGTTTCCACAGCCTCTGGAAGG + Intronic
972084905 4:35204511-35204533 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
972884567 4:43469887-43469909 CTTTTAGCTCAGGCTATGGCCGG + Intergenic
973599622 4:52529094-52529116 CTCTTTCCTCAGGTTGTGCATGG - Intergenic
974479349 4:62423382-62423404 CTGTTGCCTCAGGCAGTGCATGG + Intergenic
976648161 4:87406930-87406952 CTTTTAGCTCAGGCTATGGCTGG - Intergenic
976901639 4:90184676-90184698 GTGTTTGCTCAGCCTGCAGATGG + Intronic
977465664 4:97380881-97380903 CTGTTGCCTCAGGCAGTGCAGGG - Intronic
977847387 4:101781695-101781717 CTGTTTCCTCAGGCAATGCAGGG + Intronic
978312215 4:107396976-107396998 CTGTTTCCTCAGGCAATGCAGGG - Intergenic
978966515 4:114748412-114748434 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
979059357 4:116037165-116037187 CTGTTTGCTCACTCTGTTGATGG - Intergenic
979937356 4:126715040-126715062 CTGTTTTCTCAGCATGAGGAAGG - Intergenic
980957434 4:139443848-139443870 CTGTTGCCTCAGGCAGTGTAGGG - Intergenic
981834527 4:149039934-149039956 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
983529540 4:168795033-168795055 CTGTGTGCTCATGCGGTGGAAGG + Intronic
983785284 4:171722058-171722080 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
983905820 4:173181725-173181747 CTGTTTGCTTAGCCTGAGAAAGG + Intronic
985796181 5:1963914-1963936 ATGTGTGCTCAGCCTGTGGCAGG + Intergenic
986023244 5:3824682-3824704 CTGTTAACTGAGGATGTGGATGG + Intergenic
987887736 5:23832352-23832374 GTGATTGCTCAGGGTGTGGAAGG - Intergenic
988107438 5:26769969-26769991 CTGTTGCCTCAGGCGGTGCAAGG - Intergenic
988875816 5:35444522-35444544 CTGTTTACTCAGGATGTTGCAGG - Intergenic
989012167 5:36885450-36885472 GTGGTTGTTCAGGCTTTGGAGGG - Intronic
989246314 5:39258884-39258906 CTGTTGGTTCAGGGTATGGAAGG + Intronic
989693453 5:44171605-44171627 GTGATTGCTCAGGATGTGGGAGG - Intergenic
989976057 5:50588528-50588550 CTGTTTGGTCAGGTTGGAGATGG + Intergenic
991214807 5:64149570-64149592 CTGGTTACTCAGGCAATGGATGG + Intergenic
991656909 5:68913494-68913516 CGGTTTGCTAACACTGTGGAGGG - Intergenic
995393468 5:111663673-111663695 CAGTTTGCTCAGGGAGAGGAAGG + Intronic
995904352 5:117105591-117105613 ATGTCTGCTCAGCCTGTGCAAGG - Intergenic
996239045 5:121171581-121171603 CAGTTTCCCCAGGCTGTGCAGGG + Intergenic
996266237 5:121544059-121544081 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
997212401 5:132085160-132085182 CAGTTTGATGTGGCTGTGGATGG + Intergenic
998290676 5:140911116-140911138 CTGTTGCCTCAGGCAGTGCAGGG + Intronic
1000039968 5:157478248-157478270 TTGCTGGCTCAGGCTGAGGATGG - Exonic
1000223623 5:159237123-159237145 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
1000658812 5:163914994-163915016 CTGTTTCAGCAGGGTGTGGAGGG - Intergenic
1000730449 5:164828434-164828456 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
1001235647 5:170027136-170027158 CTTTTTGCTCAAGCTGAAGATGG - Intronic
1001909297 5:175502021-175502043 CTGGTTGGTCAGGTTGTAGATGG + Intronic
1001926077 5:175638192-175638214 CTGTTTCCTAGGGCTGTGTAAGG - Intergenic
1002948610 6:1786460-1786482 ATGCTTGCTCAGGCTGTGCGAGG - Intronic
1006062014 6:31430632-31430654 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
1007481235 6:42151466-42151488 CTCTGTGCTCAGGCTGTGGGAGG + Intergenic
1007836383 6:44677144-44677166 CTTTTAGCTGAGGCTTTGGAGGG - Intergenic
1007915268 6:45555762-45555784 CTGTGAGCTCAGGTTGTGCAGGG + Intronic
1008658709 6:53643764-53643786 CTGGTTCCTCTGGCTGTGGCCGG - Intergenic
1009308318 6:62119777-62119799 CTGTTGCCTCAGGCAGTGTATGG - Intronic
1010500538 6:76594058-76594080 CAGGTTGCTCAGGCAGTGGGCGG - Intergenic
1010524198 6:76880333-76880355 CTGTTTCTTCAGGCTGGGCATGG - Intergenic
1010581051 6:77596271-77596293 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
1010685986 6:78855971-78855993 CTTTTAGCTCAGGCTATGGCTGG + Intergenic
1010818261 6:80385582-80385604 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
1012339703 6:98104754-98104776 GTGATTGCTCAGGGTGTGGGAGG + Intergenic
1012921128 6:105222002-105222024 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
1014200877 6:118607502-118607524 CTCTTTGCTATGGCTGTGGGTGG - Intronic
1014775911 6:125509632-125509654 CTGTGTGCTCACGTGGTGGAAGG - Intergenic
1017381911 6:153841055-153841077 CTGTTTTCTCAGCCTGGGTATGG - Intergenic
1018444437 6:163842222-163842244 CTGTTTGATCAGACTCTGGCTGG + Intergenic
1018569635 6:165195546-165195568 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
1020353516 7:7251527-7251549 ATGCTAGGTCAGGCTGTGGAAGG - Intergenic
1020396380 7:7723008-7723030 CTGTTGCCTCAGGCAGTGCAGGG - Intronic
1020567695 7:9818275-9818297 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
1020709989 7:11595090-11595112 CTGTTGCCTCAGGCAGTGCAGGG - Intronic
1020964857 7:14852831-14852853 CTGTTTTCTTAAGCTGGGGATGG - Intronic
1021057232 7:16064115-16064137 CTGTGTAGTCAGGCTGTGAAAGG + Intergenic
1021258846 7:18428860-18428882 GTGTGTGCTCAGCATGTGGATGG - Intronic
1022518059 7:30988146-30988168 CTGGTTGCCCAGGCTCCGGAGGG - Intronic
1024487565 7:49935925-49935947 CTGCTTTCCCAGGCTGTTGATGG + Intronic
1024544755 7:50508009-50508031 CTGTTTGCCCAGCATGTGGCAGG - Intronic
1028141410 7:87279456-87279478 CTGTTCCCTCAGGCAGTGCAGGG - Intergenic
1028410934 7:90529893-90529915 CTGTTTGCAGAGGATGTGGATGG - Intronic
1029960914 7:104688641-104688663 CTGTTGTCTCAGGCAGTGCATGG - Intronic
1030368217 7:108670430-108670452 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
1031041198 7:116840016-116840038 CTGTGTCTTCACGCTGTGGAAGG - Intronic
1031893686 7:127324033-127324055 CTGATAGCTGAGGCTGTGGATGG + Intergenic
1033011320 7:137625605-137625627 CTGTTTGCACAGACTGGGCATGG + Intronic
1035238086 7:157513189-157513211 CTGTGTCATCAGGCTGAGGAGGG + Intergenic
1035969632 8:4233544-4233566 CTGTGTCCTCAGACAGTGGAAGG - Intronic
1036932127 8:12966270-12966292 CTCTGTGCTCAGGGTGTGGGCGG + Intronic
1039197012 8:35043889-35043911 CTGTTCGCTCTGTTTGTGGAAGG + Intergenic
1040622438 8:49105173-49105195 GTGTTTGCTCTGGCTGTGCCAGG - Intergenic
1043152974 8:76741659-76741681 CAGATTGCTCAGGCTGTTCAGGG - Intronic
1043182075 8:77097419-77097441 CTGATTGGTCAGGTTGGGGATGG + Intergenic
1044963676 8:97555418-97555440 GTGCTTGCTCAGGCTGTGCTGGG + Intergenic
1046883527 8:119337239-119337261 CTCTTTGCTGAGCCTGGGGATGG + Intergenic
1047296187 8:123572536-123572558 CTGCTGGCACAGGCTATGGAGGG + Intergenic
1048084217 8:131159676-131159698 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
1049341588 8:142115315-142115337 CGGCTTGCTCAGTCTGTGGCGGG - Intergenic
1049591463 8:143464823-143464845 CTCCTGGCTCAGGCTGGGGAGGG - Intronic
1049755788 8:144310813-144310835 CTGGCTGCTCAGGCCTTGGAAGG + Intronic
1050594148 9:7189027-7189049 CTGTTAGCTTAGACTGTGGCAGG + Intergenic
1052151764 9:25126049-25126071 CTGTTGCCTCAGGCAGTGTAGGG + Intergenic
1052718464 9:32146593-32146615 CTGTTGCCTCAGGCAGTGCAAGG - Intergenic
1053169667 9:35869517-35869539 CTTGTTCCTCAGGCTGTAGATGG + Exonic
1055000564 9:71445005-71445027 CTGTTTGCTAAGGGTGATGATGG - Intronic
1055410907 9:76028456-76028478 CTGATTGGTCAGGCTGGAGATGG + Intronic
1056046940 9:82728446-82728468 CTGTTTCCCCAGGCTTTGAATGG + Intergenic
1058412149 9:104745986-104746008 CAGTTTCCTGAGGCTGAGGAGGG - Intergenic
1058428340 9:104895792-104895814 CTGTGTCCTCAGGCTAGGGAGGG - Intronic
1059976523 9:119723845-119723867 ATGTGTTCTCAGGCTCTGGAGGG + Intergenic
1060217342 9:121746264-121746286 CTGGTTACTGAGGCTGTGTATGG + Intronic
1060260195 9:122067791-122067813 CCTTTTGCTCAGGCTGGGCATGG - Intronic
1061236914 9:129348730-129348752 CTGTTTGTTTACGCTGTGGGAGG - Intergenic
1062043013 9:134412687-134412709 CTGTTTGCTGAAGCCGGGGAGGG + Intronic
1062573963 9:137198030-137198052 CAGTTTCCCCAGGCTGGGGATGG - Intronic
1185848845 X:3466728-3466750 CCCTTTGCTGAGGCTGTGGATGG + Intergenic
1187056607 X:15746725-15746747 CTGATTGCTCAGGTTGGAGATGG + Intronic
1187604544 X:20869533-20869555 CTGTTGCCTCAGGCAGTGCAGGG - Intergenic
1191710793 X:64148492-64148514 ATGAAGGCTCAGGCTGTGGAGGG - Intergenic
1191742861 X:64453831-64453853 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
1192198671 X:69049447-69049469 TTGTTTGCTCAGGGTATGGGGGG - Intergenic
1192298049 X:69870520-69870542 CTGTTGCCTCAGGCAGTGCAGGG + Intronic
1192899764 X:75483904-75483926 CTGCTTGCTAAGGAAGTGGAAGG + Intronic
1193155970 X:78174551-78174573 CTGTTGCCTCAGGCAGTGAAGGG + Intergenic
1193339828 X:80335098-80335120 CTTTTTGGTCTAGCTGTGGAGGG - Intergenic
1193771558 X:85593528-85593550 CTGGTTTCTCAGGCAGTGGGTGG - Intergenic
1193832615 X:86307588-86307610 CTGTTACCTCAGGCAGTGCAGGG - Intronic
1193879143 X:86900270-86900292 CTGTTGCCTCAGGCAGTGCAAGG + Intergenic
1193915191 X:87354740-87354762 CTGTTGCCTCAGGCAGTGAATGG + Intergenic
1194032329 X:88832387-88832409 CTGTTGCCTCAGGCAGTGAAGGG + Intergenic
1194033860 X:88846994-88847016 CTTTTAGCTCAGGCTATGGCTGG - Intergenic
1195060330 X:101188065-101188087 CTTTTAGCTCAGGCTATGGCTGG - Intergenic
1196664178 X:118298927-118298949 CTTTTAGCTCAGGCTCTGGCTGG - Intergenic
1197372346 X:125640380-125640402 CTGTTGCCTCAGGCAGTGCATGG + Intergenic
1197591528 X:128416815-128416837 CTGTTGCCTCAGGCAGTGTAGGG - Intergenic
1198047025 X:132913365-132913387 CTGTTTGCTCAGGCTGTGGATGG + Intronic
1198783369 X:140260326-140260348 CTGTTGCCTCAGGCAGTGCAGGG + Intergenic
1199275733 X:145939944-145939966 CTGTTGCCTCAGGCAGTGCATGG - Intergenic
1200289182 X:154855675-154855697 CAGTTTCCTCAGGCAGTGCAGGG - Intronic
1200814802 Y:7520119-7520141 CCCATTGCTGAGGCTGTGGATGG - Intergenic
1201885018 Y:18872712-18872734 CTGTGTCCTCACACTGTGGAAGG + Intergenic