ID: 1198051213

View in Genome Browser
Species Human (GRCh38)
Location X:132955416-132955438
Sequence ATGTTCCCCTTAAATCTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 349}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198051213 Original CRISPR ATGTTCCCCTTAAATCTCAA TGG Intronic
900936954 1:5772275-5772297 ATGCTCCCCATAACTCTCTAGGG + Intergenic
902111210 1:14079996-14080018 ATGATCCCATCAACTCTCAAAGG + Intergenic
902261190 1:15226147-15226169 ATGTGCATCATAAATCTCAAAGG + Intergenic
906057312 1:42927327-42927349 ATGTTCCCTTTTCAGCTCAAAGG - Intronic
907435868 1:54447258-54447280 ATGTTAACCTTAAATGTAAATGG - Intergenic
908937468 1:69393429-69393451 ATGTTAACCTTAAATGTAAATGG - Intergenic
908998341 1:70186359-70186381 ATCTTCCCCTTACAAGTCAAAGG - Intronic
909262905 1:73517757-73517779 ATGTGCCCTTTATATCTGAAAGG + Intergenic
909343200 1:74554629-74554651 ATATTACCCTTAAATGTAAATGG + Intergenic
909420677 1:75461748-75461770 ATGTTCCCCCTAAGGCCCAAGGG - Intronic
910592691 1:88944423-88944445 ATGTTCTCCTTAAAACACAGGGG - Intronic
910627128 1:89318756-89318778 ATGTTAACCTTAAATGTAAATGG + Intergenic
910995326 1:93098534-93098556 ATGTTTTCCTTAACTCTCATTGG + Intronic
911340044 1:96624823-96624845 TTGTTCTGCTTAAATATCAATGG + Intergenic
913400922 1:118432020-118432042 AGGTTCCCCTTCAATTTAAAAGG - Intergenic
913724529 1:121638137-121638159 ATCTTCCCCTAAAAGCTAAACGG - Intergenic
913736649 1:121792217-121792239 ATCTTCCCGTTAAAGCTAAACGG - Intergenic
913737697 1:121804110-121804132 ATCTTCCCCTAAAAGCTAAACGG - Intergenic
913757411 1:122091840-122091862 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
913758908 1:122109182-122109204 ATCTTCCCGTTAAAGCTAAACGG + Intergenic
916076564 1:161203360-161203382 GTGTTCCCATTCACTCTCAAGGG - Intronic
917900574 1:179539181-179539203 ATATTCACCTTAAATGTAAATGG - Intronic
918838596 1:189503959-189503981 ATTTTCTCCTTTAAGCTCAATGG - Intergenic
918852168 1:189706564-189706586 CTGTTCTACTTAAATCTCCAGGG + Intergenic
919060407 1:192624843-192624865 ATATTAACCTTAAATGTCAATGG - Intergenic
919164323 1:193873022-193873044 ATGTTAACCTTAAATGTAAATGG + Intergenic
919580349 1:199364659-199364681 ATATTACCCTTAAATGTAAATGG - Intergenic
920203004 1:204271816-204271838 ATGTTGCCCTATAATTTCAAAGG - Intronic
922435466 1:225600822-225600844 ATTTTCCTCTTAAATCTCCCAGG - Intronic
922692126 1:227701784-227701806 ATGTTAACCTTAAATGTAAATGG + Intergenic
1063318456 10:5030378-5030400 ATGTTAACCTTAAATGTAAATGG - Intronic
1065814197 10:29469929-29469951 GTGCTCCCTTTAAATATCAAAGG + Intronic
1066787272 10:39019002-39019024 ATTTTCCCCATAGATGTCAATGG + Intergenic
1066792237 10:39078491-39078513 TTTTTCCCCATAGATCTCAAAGG - Intergenic
1066927600 10:41717324-41717346 TTTTTCCCCCTAAGTCTCAATGG - Intergenic
1066928245 10:41724506-41724528 TTATTCCCCATAGATCTCAACGG - Intergenic
1068895432 10:62194367-62194389 ATTTTCCCCTTACATTTCAAAGG - Exonic
1070490739 10:76973966-76973988 ATCATCCCCTTAAATCTCACTGG - Intronic
1071154409 10:82672716-82672738 ATGTTCCCCTCAAATCTGCATGG + Intronic
1071401560 10:85278377-85278399 ATGTTAACCTTAAATGTAAAAGG - Intergenic
1072031512 10:91526472-91526494 ATGTTCCCGTTAAAGATCAAAGG + Intergenic
1072486458 10:95861024-95861046 GTCTTCCCCTTATATCTCAATGG + Intronic
1073726396 10:106236276-106236298 ACCTTCCCCTTAAGACTCAATGG + Intergenic
1074601477 10:114917993-114918015 ATGTTCTCTTTAAATCCCTAAGG - Intergenic
1076434007 10:130427238-130427260 ATGGTGCTCTCAAATCTCAAAGG + Intergenic
1078781661 11:14444482-14444504 CTATTTCCCTTAAATCTCAAAGG - Intronic
1079463327 11:20704496-20704518 ATATTGACCTTAAATCTAAATGG - Intronic
1079513676 11:21240876-21240898 ATGTTTCCCTTAAGCCTCTAGGG - Intronic
1079654541 11:22972229-22972251 ATATTCACCTTAAATGTAAATGG - Intergenic
1080081181 11:28220553-28220575 ATATTAACCTTAAATGTCAATGG - Intronic
1080616561 11:33949557-33949579 ATTTTCCTCTTAAATGCCAACGG + Intergenic
1080683264 11:34495537-34495559 AGGCTCCCCTTAAAACTCAAAGG + Intronic
1081363507 11:42207478-42207500 ATATTCACCTTAAATGTAAATGG + Intergenic
1081405243 11:42690154-42690176 ATATTAACCTTAAATGTCAATGG + Intergenic
1081546971 11:44078573-44078595 ATGTCCCCCTCAAATCTCCCTGG + Intronic
1082575638 11:54799755-54799777 ATATTAACCTTAAATGTCAATGG + Intergenic
1082602412 11:55174215-55174237 TTTTTCACCTTAAGTCTCAATGG + Intergenic
1082754920 11:57064901-57064923 ATATTAACCTTAAATGTCAATGG + Intergenic
1082967983 11:58987907-58987929 ATATTACCCTTAAATGTAAATGG - Intronic
1083485410 11:62980477-62980499 ATGTTTCCCTTAACTGTCATGGG + Intronic
1083507235 11:63169318-63169340 ATGTTAACCTTAAATGTAAATGG + Intronic
1084842403 11:71866202-71866224 ACATTGCCCTAAAATCTCAATGG - Intronic
1085248191 11:75121459-75121481 ATATTAACCTTAAATGTCAATGG + Intronic
1087362916 11:97183460-97183482 CTGCTGCCCTTAAATTTCAAAGG + Intergenic
1087922141 11:103878521-103878543 ATGTGCCTCTTAATCCTCAAAGG + Intergenic
1089069122 11:115685523-115685545 ATGTACCCCTTGAACCTAAAAGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1092310730 12:7348972-7348994 TTTTTCCCCTTAAGTCTCAGAGG - Intronic
1093660128 12:21747037-21747059 ATGTTTACCTTAAATGTAAATGG + Intronic
1094287185 12:28808942-28808964 ATGATCCCCATAAATCTTTATGG + Intergenic
1094451849 12:30590497-30590519 ATGTTAACCTTAAATGTAAATGG + Intergenic
1094544951 12:31395988-31396010 ATTTTCCCCTAGAATTTCAAGGG - Intronic
1094783783 12:33822127-33822149 TTCTTCCACTTAAATTTCAAAGG - Intergenic
1095077851 12:37954354-37954376 ATCTTCACCTAAAAACTCAAAGG - Intergenic
1095397836 12:41780919-41780941 ATGTTCCCTTGAAATGGCAAAGG + Intergenic
1095935442 12:47675397-47675419 ATATTACCCTTAAATGTAAATGG + Intronic
1096019476 12:48311247-48311269 ATGTTCTACTTAAAAATCAAAGG - Intergenic
1097291557 12:57920461-57920483 AACTTCCCCTTACATCTCATTGG + Intergenic
1097340145 12:58428017-58428039 ATATTACCCTTAAATGTGAATGG + Intergenic
1097656420 12:62368795-62368817 ATATTCACCTTAAATGTAAATGG - Intronic
1098201622 12:68062461-68062483 ATATTAACCTTAAATCTAAATGG - Intergenic
1098539016 12:71630845-71630867 ATGTTCCTGTTAAATCAAAACGG + Exonic
1098699330 12:73604900-73604922 ATTTTCCCCCTATATGTCAAAGG - Intergenic
1099187900 12:79535727-79535749 CTCTTCCACTTAAATCTCATTGG - Intergenic
1099814793 12:87631664-87631686 ATATTACCTTTAAATGTCAATGG + Intergenic
1108595939 13:51949317-51949339 TAGTTCACTTTAAATCTCAATGG - Intronic
1109949413 13:69481847-69481869 ATGTTAACCTTAAATGTAAATGG - Intergenic
1112820291 13:103326499-103326521 CTCTTCCCCTTGAATCTCCATGG + Intergenic
1112918960 13:104586440-104586462 CTGTTCCACATAAATCTCCAGGG + Intergenic
1113590893 13:111500115-111500137 ATGTTAACCTTAAATGTAAATGG - Intergenic
1114133320 14:19818673-19818695 ATGTTAACCTTAAATGTAAATGG - Intronic
1114167412 14:20234271-20234293 ATGTTAACTTTAAATGTCAATGG - Intergenic
1114558292 14:23574885-23574907 GTGATCCCCTTACCTCTCAAGGG + Intronic
1114710287 14:24770589-24770611 ATGTTAACCTTAAATGTAAATGG + Intergenic
1114810254 14:25890826-25890848 TTTTTCCCCTTAAATCTACAGGG - Intergenic
1115124419 14:29974487-29974509 ATGTTAACCTTAAATGTAAATGG + Intronic
1115294465 14:31810609-31810631 ATGTTAACCTTAAATGTAAATGG - Intronic
1115782423 14:36784496-36784518 TTGTTAGCCTTAAATCTCACTGG - Intronic
1115793299 14:36904367-36904389 GTTTTTCCCTTAAATTTCAAAGG + Intronic
1115911945 14:38266934-38266956 ATGTTAGCCTTAAATGTAAATGG - Intergenic
1116160005 14:41256235-41256257 ATATTCACCTTAATTATCAATGG - Intergenic
1116227407 14:42170032-42170054 ATGTTAACCTTAAATGTAAATGG - Intergenic
1117191400 14:53295415-53295437 ATGTTCACATGGAATCTCAAAGG + Intergenic
1117629773 14:57678519-57678541 ATATTACCCTTAAATGTAAATGG + Intronic
1117665637 14:58053232-58053254 ATGTTCTCCTTGAATTTTAAAGG - Intronic
1118324926 14:64774306-64774328 ATTTTCCTTTTAAATCTGAAGGG + Intronic
1118544928 14:66875407-66875429 ATGTTAACCTTAAATGTAAATGG + Intronic
1119930373 14:78540609-78540631 ATATTACCCTTAAATGTAAATGG - Intronic
1121899195 14:97676713-97676735 ATATTAACCTTAAATCTAAATGG + Intergenic
1123576406 15:21674482-21674504 ATGTTAACCTTAAATGTAAATGG - Intergenic
1123613030 15:22116950-22116972 ATGTTAACCTTAAATGTAAATGG - Intergenic
1125227387 15:37410278-37410300 ATGTTAACCTTAAATGTAAATGG + Intergenic
1126217175 15:46169291-46169313 AAATTCCCATGAAATCTCAAGGG - Intergenic
1126494284 15:49273118-49273140 ATGTTCCTATAAAAGCTCAATGG - Intronic
1126641184 15:50828630-50828652 AGTTTCCCCTTCATTCTCAAGGG - Intergenic
1127937897 15:63660826-63660848 ATTTTCCCTTAAAAACTCAAGGG - Intronic
1130697938 15:86149277-86149299 ATGTTAACCTTAAATGTAAATGG + Intronic
1202985274 15_KI270727v1_random:408727-408749 ATGTTAACCTTAAATGTAAATGG - Intergenic
1133432318 16:5748862-5748884 ATATTAACCTTAAATGTCAATGG - Intergenic
1133690395 16:8208975-8208997 ATGTTCTCCAGAAATGTCAAAGG + Intergenic
1136009548 16:27354468-27354490 AAATTCCCCTTACATCTCATTGG + Intronic
1137440568 16:48495490-48495512 AACTTCCACTTAAATCTCACTGG - Intergenic
1137619070 16:49864529-49864551 ATGTTCTTCTGAAATCTCCATGG - Intergenic
1138646520 16:58429589-58429611 ATTTGGCCCTTAAATCTCATAGG + Intergenic
1139114738 16:63936420-63936442 AGCTTCCCCATAAATCCCAAGGG + Intergenic
1139152503 16:64399759-64399781 ATATTCTTCTTAAAACTCAATGG - Intergenic
1140293301 16:73684670-73684692 ATGTGCCCCTGCAATCACAAGGG + Intergenic
1143831452 17:9655042-9655064 AAGTCTCCTTTAAATCTCAAGGG + Intronic
1143917624 17:10305465-10305487 ATGGTCCCATTAAATGTGAAAGG - Intronic
1144931373 17:18861806-18861828 ATGTTTCCCATAAATCTCTAAGG + Intronic
1146038640 17:29430731-29430753 ATGATCCCCATAAATCTTTATGG + Intronic
1146130888 17:30274072-30274094 ATGTTCCCTGTAAAACTCCAAGG + Exonic
1149240338 17:54641346-54641368 ATGTTAACCTTAAATTTAAATGG + Intergenic
1151256984 17:72885573-72885595 ATCTACCTCTAAAATCTCAATGG + Intronic
1153092804 18:1367859-1367881 ATTTTCCTATTAAATCTCTATGG + Intergenic
1154101324 18:11477427-11477449 ATGTTAACCTTAAATGTAAATGG - Intergenic
1155546345 18:26919757-26919779 AAATTCCCCTTTAATCTCCAGGG + Intronic
1155719281 18:28991085-28991107 TTTTCCTCCTTAAATCTCAATGG + Intergenic
1155725649 18:29078903-29078925 ATGTTCAGTTTAAATATCAAAGG - Intergenic
1157949583 18:52019637-52019659 ATTTTCTTTTTAAATCTCAAAGG + Intergenic
1158917435 18:62149577-62149599 ATGTTTGACTTAAATCTCATTGG - Intronic
1158923988 18:62231129-62231151 AATTTCTCCTTAAATGTCAATGG + Intronic
1163880954 19:19921935-19921957 ATATTAACCTTAAATGTCAATGG - Intronic
1164876146 19:31691757-31691779 ATGTTCACCTTTAAACTCAAGGG + Intergenic
926475162 2:13312951-13312973 ATATTAACCTTAAATGTCAATGG - Intergenic
927284093 2:21338063-21338085 ATATTAACCTTAAATCTAAATGG + Intergenic
928314310 2:30233841-30233863 ATGTTCCACTTAAAGCCCCAAGG - Intronic
928758949 2:34559306-34559328 ATATTACCCTTAAATGTAAATGG - Intergenic
930803245 2:55464292-55464314 ATGTTAACCTTAAATGTAAATGG + Intergenic
931306797 2:61036779-61036801 ATGTTAACCTTAAATGTAAATGG + Intronic
933248064 2:79997808-79997830 AGGTTCGCCTTAATTCTCCATGG - Intronic
933326650 2:80846389-80846411 ATGTATCTCTTACATCTCAAGGG - Intergenic
935843827 2:107143263-107143285 ATGTTAACCTTAAATGTAAATGG - Intergenic
937759739 2:125587003-125587025 ATGTTCCTGTTGAAGCTCAAGGG - Intergenic
937762589 2:125623572-125623594 ATATTACCCTTAAATGTAAATGG + Intergenic
940067039 2:149641868-149641890 ATGTTAACCTTAAATGTAAACGG - Intergenic
940599023 2:155834392-155834414 ATCTTCCCCTTCCCTCTCAAGGG + Intergenic
940602816 2:155882357-155882379 ATATTAACCTTAAATGTCAATGG + Intergenic
940808050 2:158209961-158209983 ATATTCACCTTAAATGTAAATGG + Intronic
941114808 2:161460387-161460409 ATGTTAACCTTAAATGTCAATGG - Intronic
942318380 2:174714804-174714826 ATGAGCCTCTTCAATCTCAACGG + Intergenic
943597531 2:189876140-189876162 AAGTTCCCCTAAAATTTCACAGG - Intronic
944950484 2:204743380-204743402 ATGTTCCACTTAATTTTAAATGG + Intronic
948510863 2:238464185-238464207 ATATTCCCCCTAATACTCAATGG - Intergenic
1168742027 20:200213-200235 ATGTTCCCTTTAAGCCCCAAGGG + Intergenic
1168996793 20:2139194-2139216 ATGTTCCCCTCATATCTCCCAGG + Intronic
1169423894 20:5481492-5481514 ATGATCCCCATAAATCTTTATGG + Intergenic
1170122296 20:12924390-12924412 ATGCTCCCTTTAAACCCCAAAGG + Intergenic
1170730200 20:18967562-18967584 ATGTTAACCTTAAATGTAAATGG + Intergenic
1171268170 20:23790600-23790622 ATGTTAACCTTAAATGTAAATGG + Intergenic
1176949454 21:15027767-15027789 ATTTTCCCTCTAAATCTAAACGG + Intronic
1177181770 21:17752066-17752088 ATATTAACCTTAAATGTCAATGG - Intergenic
1177738897 21:25129108-25129130 ATTTTCCCAATAAAACTCAATGG + Intergenic
1183021260 22:35028931-35028953 ATATTCACCTTAAATGTAAAAGG - Intergenic
949680780 3:6512184-6512206 CTGTTCCCTTTAAATCTGAGGGG - Intergenic
951061315 3:18210211-18210233 ATGGTCCACTTAAGTCTCCAGGG - Intronic
952146232 3:30535428-30535450 ATGTACCCCTTCAATCTCTGGGG - Intergenic
952290743 3:32012592-32012614 ATGTTAACCTTAAATGTAAATGG + Intronic
953116380 3:39996182-39996204 ATGTTAACCTTAAATGTAAATGG + Intronic
954490393 3:50899468-50899490 ATATTCACTTTAAATGTCAATGG - Intronic
954500592 3:51010611-51010633 ATATTCACCTTAAATGTAAACGG - Intronic
955246126 3:57227074-57227096 ATGTTTCTTTTAAATCACAAAGG - Intergenic
955636409 3:61034755-61034777 ATGTACCCCAGAAATCTCACTGG + Intronic
956101072 3:65768883-65768905 ATTTTCCCCTTTAAACTCCAGGG + Intronic
956171466 3:66436898-66436920 ATGTTCCCTTTGAGTCTCCAAGG - Intronic
957061703 3:75487438-75487460 ATATTAACCTTAAATGTCAATGG - Intergenic
958166432 3:89883442-89883464 ATATTCACCTTAAATGTAAATGG - Intergenic
958167966 3:89901536-89901558 ATATTCACCTTAAATGTAAATGG + Intergenic
958694355 3:97509177-97509199 ATATTACCCTTAAATGTAAATGG - Intronic
959550166 3:107645869-107645891 ATGTTCCACTGAAATCACAATGG + Exonic
959883316 3:111471862-111471884 ATGTTAACCTTAAATGTAAATGG - Intronic
960770427 3:121187691-121187713 ATGTTAACCTTAAATGTAAATGG + Intronic
961267594 3:125657361-125657383 ATGTTCCCCTGAAGACTCAATGG + Intergenic
961268018 3:125663133-125663155 ATGTTCCTCTAAAAGCTCAATGG + Intergenic
961972833 3:130988650-130988672 ATGATCCCCATAAATCTTTATGG - Intronic
962691055 3:137898741-137898763 ATGTTAACCTTAAATGTAAATGG + Intergenic
962921363 3:139953384-139953406 ATGTTCCCCCTGAACCTCTAGGG + Intronic
964712990 3:159691591-159691613 ATATTACCCTTAAATGTAAATGG - Intronic
966071408 3:175883724-175883746 ATGTTAACCTTAAATGTAAATGG - Intergenic
966977534 3:185098537-185098559 GTTTTCCCATAAAATCTCAAAGG + Intronic
969005588 4:4017528-4017550 ATATTAACCTTAAATGTCAATGG - Intergenic
969132282 4:5000354-5000376 ATATTAACCTTAAATGTCAATGG - Intergenic
969164601 4:5296755-5296777 ATATTAACCTTAAATGTCAATGG - Intronic
969747287 4:9082675-9082697 ATATTAACCTTAAATGTCAATGG + Intergenic
969783505 4:9432254-9432276 ATATTGCCCTAAAATCTCAATGG - Intergenic
969807394 4:9620052-9620074 ATATTAACCTTAAATGTCAATGG + Intergenic
969850360 4:9951751-9951773 ATGTTCCTCATTATTCTCAATGG + Intronic
971437451 4:26642579-26642601 ATATTAACCTTAAATGTCAATGG + Intronic
971438472 4:26653865-26653887 ATATTAACCTTAAATGTCAATGG - Intronic
971441905 4:26696008-26696030 ATATTAACCTTAAATGTCAATGG + Intronic
972696856 4:41455299-41455321 GTGTTCCCCTTAACTCTAAAAGG + Intronic
973013668 4:45109115-45109137 ATGTTAACCTTAAATGTAAATGG - Intergenic
973341641 4:49011455-49011477 ATATTCACCTTAAATGTAAATGG - Intronic
973693719 4:53468492-53468514 ATATTCACCTTAAATGTAAATGG + Intronic
973715005 4:53667793-53667815 ATGTTAACCTTAAATGTAAATGG - Intronic
974966911 4:68772206-68772228 ATATTAACCTTAAATGTCAATGG - Intergenic
975212782 4:71720741-71720763 ATATTAACCTTAAATCTAAATGG - Intergenic
975388869 4:73792839-73792861 ATATTCACCTTAAATTTAAATGG - Intergenic
975750906 4:77522701-77522723 ATATTAACCTTAAATCTAAATGG - Intronic
976580327 4:86728833-86728855 ATGTTAACCTTAAATGTAAATGG - Intronic
977164179 4:93675179-93675201 ATTTCTCCCTTACATCTCAAAGG + Intronic
977351953 4:95899498-95899520 ATGTGTCCCTGAACTCTCAATGG + Intergenic
977524110 4:98124168-98124190 ATGTTAACCTTAAATGTAAATGG - Intronic
977775859 4:100918311-100918333 ATATTACCCTTAAATGTAAATGG + Intergenic
978055120 4:104254076-104254098 ATGTTAACCTTAAATGTAAATGG + Intergenic
978206387 4:106085096-106085118 ATACTACCCTTAAATGTCAATGG + Intronic
978224085 4:106313697-106313719 ATTTTCCCCTTAAAGCCCAATGG - Intronic
978602901 4:110447428-110447450 ATGTCCCACTTAACTCTCAGGGG - Intronic
978906401 4:114011137-114011159 ATGTTAACCTTAAATATAAATGG - Intergenic
980159533 4:129143127-129143149 ATGTTCCCCTTTCATCTATAAGG - Intergenic
983336687 4:166403300-166403322 AAATTCACCTGAAATCTCAAGGG + Intergenic
985412385 4:189699218-189699240 ATGTTCCCTCTCAATCTCAGAGG + Intergenic
986501638 5:8407229-8407251 AAGCTCCCCTTAACTCTCCATGG + Intergenic
988756021 5:34251480-34251502 TTGTTCACATTAAATCTTAATGG - Intergenic
988794918 5:34644668-34644690 ATATTAACCTTAAATGTCAATGG - Intergenic
988859205 5:35259952-35259974 ATATTAACCTTAAATGTCAATGG - Intergenic
989569706 5:42933864-42933886 ATATTGCCCTTAAATGTAAATGG + Intergenic
989635862 5:43532622-43532644 TTGTTCACATTAAAACTCAAAGG + Intronic
989947822 5:50260973-50260995 ATGTTAACTTTAAATGTCAATGG - Intergenic
990212543 5:53495779-53495801 ATATTACCCTTAAATGTAAATGG + Intergenic
990901099 5:60749933-60749955 AACTTCCACTTACATCTCAATGG - Intergenic
991199804 5:63978875-63978897 ATATTAACCTTAAATGTCAATGG - Intergenic
992873697 5:81030800-81030822 ATATTCACCTTAAATGTAAATGG + Intronic
992899444 5:81278777-81278799 ATATTCCCCTTAAATGTAAATGG + Intergenic
993255523 5:85586221-85586243 ATATTACCCTTAAATGTAAATGG - Intergenic
994039866 5:95246327-95246349 ATGTTAACCTTAAATGTAAATGG + Intronic
994917824 5:106002870-106002892 ATGTTAACCTTAAATGTAAATGG - Intergenic
995598450 5:113772007-113772029 ATGATCCCCATAAATCTTTATGG + Intergenic
997137943 5:131346152-131346174 ATGTTTACCTTAAATGTAAATGG + Intronic
997140624 5:131376509-131376531 ATGTACCCCCTGAACCTCAAAGG - Intronic
998779927 5:145645525-145645547 ATGTTAACCTTAAATGTAAATGG - Intronic
1000598055 5:163238288-163238310 ATGTTAACCTTAAATGTAAATGG + Intergenic
1002996332 6:2288680-2288702 ATGTTAACCTTAAATGTTAATGG + Intergenic
1003274318 6:4636558-4636580 GTGTTACCCTTAAATCCCAATGG + Intergenic
1005554670 6:26963276-26963298 TTGTTCACATTAAATCTTAATGG - Intergenic
1005674022 6:28136061-28136083 TTGTTCTCCTTAAATCTCTGTGG + Intergenic
1005944987 6:30588981-30589003 ATGTTCCCCTAATATGACAAAGG - Intronic
1008592936 6:53011640-53011662 ATGTTCCCCTCAGTTCTGAAGGG + Intronic
1009740024 6:67732542-67732564 ATGTTAACCTTAAATGTAAATGG - Intergenic
1009833958 6:68973061-68973083 ATGTTCCCATTAAAACACATAGG - Intronic
1010105431 6:72162379-72162401 ATATTAACCTTAAATGTCAATGG - Intronic
1010814507 6:80341737-80341759 ATTTTGCCCTTAATTCTCCATGG + Intronic
1011020474 6:82807476-82807498 ATGTTAACCTTAAATGTCAATGG - Intergenic
1011554248 6:88557973-88557995 ATTTTCCCCTTACATCTCACCGG + Intergenic
1011760912 6:90564218-90564240 ATATTCACCTTAAATGTAAATGG + Intronic
1011776575 6:90737733-90737755 ATGTTAGCCTTAAATGTAAATGG - Intergenic
1012300877 6:97586433-97586455 CTGTTTCCCTTAAATTTCAGGGG - Intergenic
1012490460 6:99777990-99778012 ATATTAACCTTAAATGTCAATGG - Intergenic
1012713435 6:102637693-102637715 ATGATCCCCATAAATCTCTATGG - Intergenic
1012847086 6:104404202-104404224 AAATTCACCTTGAATCTCAAAGG + Intergenic
1013689653 6:112626573-112626595 AGGTTTCCCTTAAATCTGAGCGG + Intergenic
1013932201 6:115547173-115547195 ATGTTAACCTTAAATGTTAATGG + Intergenic
1014558922 6:122866879-122866901 ATGTTGACCTAAAATCTGAAGGG - Intergenic
1014589439 6:123245245-123245267 ATGTTAACCTTAAATGTAAATGG + Intronic
1015456415 6:133431780-133431802 GTGTTCCCCTTAAATGTTCATGG + Intronic
1017247752 6:152245556-152245578 TTTTTCCCCATAAATCTAAAAGG + Intronic
1018355361 6:163009243-163009265 ATGGTCACATGAAATCTCAATGG - Intronic
1018473617 6:164119130-164119152 AGGTTGCCATTAAATTTCAATGG - Intergenic
1019055941 6:169223337-169223359 ATGGTCCCCTTGGATCCCAAAGG - Exonic
1020325714 7:6973968-6973990 ATATTAACCTTAAATGTCAATGG - Intergenic
1020619311 7:10498639-10498661 ATATTAGCCTTAAATGTCAATGG + Intergenic
1020773950 7:12430325-12430347 ATATTACCCTTAAATGTAAATGG - Intergenic
1021466859 7:20954085-20954107 ATTTTTGCCTTAAGTCTCAAGGG + Intergenic
1021895168 7:25226878-25226900 ACGTTCCTCCCAAATCTCAATGG + Exonic
1022594804 7:31703067-31703089 ATTTTGCCCATAAATCTAAAAGG + Intronic
1024770892 7:52722254-52722276 TTGTTTCTCTTAAATCTCAAAGG - Intergenic
1024990347 7:55230078-55230100 ATGTTAACCTTAAATGTAAATGG - Intronic
1025536718 7:61957370-61957392 TTTTTCCCCATAGATCTCAATGG - Intergenic
1025536855 7:61958922-61958944 TTTTTCCCCTTAAGCCTCAATGG - Intergenic
1025714681 7:63943733-63943755 ATATTCACCTTAAATGTAAATGG + Intergenic
1025761059 7:64392319-64392341 ATGTACCCATGAAAGCTCAATGG + Intergenic
1027525924 7:79268665-79268687 ATGTTTCCCTTTAATTTCAGTGG + Intronic
1029087289 7:98021650-98021672 ATGTTGCCATCAAATCTCCAGGG + Intergenic
1030424812 7:109362029-109362051 ATTTTCCCCTTAAATGGGAAGGG + Intergenic
1030627936 7:111864288-111864310 ATGCTCACATCAAATCTCAAAGG + Intronic
1031773087 7:125870469-125870491 ATGTTCCCATAAAATTTCACTGG - Intergenic
1032763876 7:134972341-134972363 ATATTCCCATTGAAACTCAAAGG - Intergenic
1033033977 7:137853647-137853669 ATGTTCCCTGCAAATCTAAATGG - Intergenic
1034025260 7:147696163-147696185 ATATTTACCTTAAATGTCAATGG - Intronic
1034249809 7:149679905-149679927 AAGTTCCTATGAAATCTCAAGGG - Intergenic
1034377091 7:150655669-150655691 ATGATCCCCTTGAATCTTTATGG + Intergenic
1035021163 7:155801270-155801292 AGGGTCCCCTTAAATCTGAGTGG - Exonic
1036048169 8:5166971-5166993 CTGTTTGCCTCAAATCTCAATGG + Intergenic
1036054913 8:5240799-5240821 ATGTTAACCTTAAATGTAAATGG + Intergenic
1036732811 8:11281200-11281222 ATGATCCCCATAAATCTTTATGG + Intergenic
1036835521 8:12061826-12061848 ATATTGCCCTAAAATCTCAATGG + Intergenic
1036857364 8:12308390-12308412 ATATTGCCCTAAAATCTCAATGG + Intergenic
1037061473 8:14515718-14515740 GTGTTCACCTTGAATTTCAATGG - Intronic
1038917018 8:32035922-32035944 ATATTACCCTTAAATGTAAATGG - Intronic
1039623835 8:39026979-39027001 ATGTACCCCCTAAATCTAAAAGG - Intronic
1040125956 8:43738045-43738067 TTTTTCCCCATAAGTCTCAATGG - Intergenic
1040129602 8:43779483-43779505 TTATTCCCCTTAGCTCTCAATGG - Intergenic
1040129703 8:43780786-43780808 TTTTTCCCCATAAATCTCACTGG - Intergenic
1040130985 8:43796275-43796297 TTTTTCCCCATAGATCTCAATGG - Intergenic
1040134357 8:43835300-43835322 GTTTTCCCCTTAAGCCTCAATGG - Intergenic
1040275241 8:46010389-46010411 ATTTTCCCCTAAAATCTCAAGGG - Intergenic
1043866991 8:85386424-85386446 ATGTTCTCCATAAATCTCAGAGG + Intronic
1044015674 8:87046651-87046673 AGGTTCCCCTTATATCTAATGGG + Intronic
1044307179 8:90651164-90651186 ATCTTTCCTTTGAATCTCAAAGG - Intronic
1045438560 8:102188170-102188192 ATGTTCACCTTCAATCTTACAGG - Intergenic
1045635514 8:104182983-104183005 TTTTTTCCCCTAAATCTCAAAGG - Intronic
1050234156 9:3560853-3560875 ATATTACCCTTAAATGTAAATGG - Intergenic
1050239694 9:3622326-3622348 ATATTACCCTTAAATGTAAACGG - Intergenic
1050660965 9:7882012-7882034 ATATTAACCTTAAATGTCAATGG + Intronic
1051958466 9:22728082-22728104 ATATTACCCTTAAATGTAAATGG + Intergenic
1057924413 9:99131232-99131254 ATTTTCTGCTTAAATATCAAAGG + Intronic
1058496633 9:105565298-105565320 ATGTTAACCTTAAATGTAAATGG + Intronic
1058558835 9:106202332-106202354 ATATTAACCTTAAATCTAAATGG - Intergenic
1058595140 9:106607120-106607142 ATGTTAACCTTAAATGTAAATGG + Intergenic
1061707515 9:132464168-132464190 ATGTTTCCCTAAAATATGAAAGG - Intronic
1203670208 Un_KI270755v1:3762-3784 ATGTTCCCTCTCAATCTCAGAGG - Intergenic
1187737682 X:22321556-22321578 ATCTTCCCCTTCACCCTCAAGGG + Intergenic
1188084362 X:25884480-25884502 ATGTTAACCTTAAATGTAAATGG + Intergenic
1189415865 X:40812863-40812885 ATGATCCCCATAAATCTTCATGG + Intergenic
1189930289 X:46002321-46002343 ATATTAACCTTAAATCTAAATGG - Intergenic
1190603190 X:52113260-52113282 ATATTAACCTTAAATGTCAATGG + Intergenic
1191076479 X:56459195-56459217 ATGTTAACCTTAAATGTAAATGG - Intergenic
1191173052 X:57469248-57469270 ATATTAACCTTAAATGTCAATGG + Intronic
1191176161 X:57503876-57503898 ATATTAACCTTAAATGTCAATGG + Intergenic
1191293989 X:58838704-58838726 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
1191298586 X:58900073-58900095 ATCTTCACCTAAAAGCTCAACGG + Intergenic
1191299985 X:58918926-58918948 ATCTTCACCTAAAATCTAAACGG + Intergenic
1191367176 X:59816485-59816507 ATCTTCACCTAAAAGCTCAACGG + Intergenic
1191379461 X:59980890-59980912 ATCTTCACCTAAAAGCTCAACGG + Intergenic
1191386498 X:60074823-60074845 ATCTTCACCTAAAAGCTCAACGG + Intergenic
1191397624 X:60223950-60223972 ATCTTCACCTAAAAGCTCAACGG + Intergenic
1191413315 X:60434417-60434439 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
1191433697 X:60707371-60707393 ATCTTCACCTAAAAGCTCAACGG + Intergenic
1191462428 X:61091562-61091584 ATCTTCCCCTAAAAGCTAAACGG + Intergenic
1191497776 X:61564874-61564896 ATCTTCACCTAAAAGCTCAACGG + Intergenic
1191541211 X:62145943-62145965 ATCTTCACCTAAAATCTAAACGG + Intergenic
1191543985 X:62182983-62183005 ATCTTCACCTAAAAGCTCAACGG + Intergenic
1191559324 X:62388001-62388023 ATCTTCACCTAAAAGCTCAACGG + Intergenic
1191578363 X:62732520-62732542 ATTTTCCCCATAAGCCTCAATGG + Intergenic
1191943125 X:66501107-66501129 ATGCACCCCTCAAATCTCCATGG - Intergenic
1192406628 X:70892400-70892422 ATGTTAACCTTAAATGTAAATGG + Intronic
1192525676 X:71841916-71841938 ATATTACCCTTAAATGTAAATGG - Intergenic
1193051171 X:77101401-77101423 ATGTTAACCTTAAATGTAAATGG - Intergenic
1193065600 X:77256177-77256199 ATATTACCCTTAAATGTAAATGG + Intergenic
1193267066 X:79484230-79484252 ATGTTAACCTTAAATGTAAATGG + Intergenic
1193514273 X:82445033-82445055 ATATTGCCATTAACTCTCAAAGG - Intergenic
1194312303 X:92326421-92326443 ATGTTCCCCTTGAATCTCAGTGG - Intronic
1195487718 X:105428464-105428486 AGATTCCCCCTAAATCTCTAGGG + Intronic
1195829983 X:109046254-109046276 ATGTTCCACAGATATCTCAAAGG + Intergenic
1196155854 X:112429131-112429153 ATGATCACCTTAAACATCAATGG - Intergenic
1196225656 X:113163263-113163285 ATCTTGTCCTTAAACCTCAATGG + Intergenic
1196269585 X:113695902-113695924 ATATTAACCTTAAATGTCAATGG - Intergenic
1196467278 X:115985151-115985173 ATATTAACCTTAAATGTCAATGG + Intergenic
1197242986 X:124139453-124139475 ATGATCCCCATAAATCTTTATGG + Intronic
1197614087 X:128673004-128673026 ATATTACCCTTAAATGTAAACGG - Intergenic
1197625048 X:128792447-128792469 ATGTTAACCTTAAATGTAAATGG + Intergenic
1198051213 X:132955416-132955438 ATGTTCCCCTTAAATCTCAATGG + Intronic
1198267086 X:135019956-135019978 ATATTCCCTATAAATTTCAAGGG + Intergenic
1199050619 X:143232600-143232622 ATGTTTTCCTTAAAGCTTAAAGG - Intergenic
1200620573 Y:5440536-5440558 ATGTTCCCCTTGAATCTCAGTGG - Intronic
1201591430 Y:15618953-15618975 ATATTAACCTTAAATGTCAATGG + Intergenic
1201775767 Y:17664066-17664088 ATTTTCCCCTTAGGCCTCAATGG + Intergenic
1201825789 Y:18241926-18241948 ATTTTCCCCTTAGGCCTCAATGG - Intergenic
1201974852 Y:19838093-19838115 ATGTTAACCTTAAATGTAAATGG - Intergenic