ID: 1198051392

View in Genome Browser
Species Human (GRCh38)
Location X:132956341-132956363
Sequence TAGGGGGGAAAGCGGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 701
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 660}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198051392 Original CRISPR TAGGGGGGAAAGCGGGGGGA GGG Intronic
900141601 1:1141302-1141324 TGGGGGTGAGGGCGGGGGGATGG - Intergenic
900395163 1:2450527-2450549 TTGGGGGGCAAGCGGGGAGTGGG - Intronic
901086335 1:6614205-6614227 ACGAGGGGAAAGCGGGGGAAGGG - Intronic
901241562 1:7697144-7697166 TAGGGAGGAAAGTGGCAGGAAGG + Intronic
901459787 1:9384596-9384618 AAGGGGAGAGAGCGAGGGGAAGG - Intergenic
901648378 1:10728758-10728780 GAGGGGGGACAGCTGGGGGCCGG + Intronic
901652161 1:10749231-10749253 TAGGGGGGAAAGATGGAGGGAGG - Intronic
901877273 1:12174002-12174024 CAGGGGGGAGTGCGGGGGGAGGG + Intronic
901934217 1:12616816-12616838 AAGGGGGGAAGGCGGGGGAGGGG + Intronic
902086818 1:13869016-13869038 TCGTGGGGACAGCGGGAGGAGGG + Intergenic
902374953 1:16026292-16026314 TATGGGGGAGAGCTGGGGCAGGG - Intronic
903233462 1:21935687-21935709 TCGGGGGCAGAGCTGGGGGAAGG + Intronic
903508296 1:23853620-23853642 AAGGGGGGAAAGGCGGGGAAAGG + Intronic
903596855 1:24502208-24502230 GAGGAGGGAGAGCGGGAGGAGGG + Intergenic
905009291 1:34736357-34736379 TTGGGGAGAAAGCTGGGTGAGGG + Intronic
905462452 1:38130578-38130600 TTGGGGGGAAAGGGGGAGGGAGG - Intergenic
905529235 1:38663451-38663473 TAGGATGGATAGCAGGGGGAAGG + Intergenic
906841280 1:49142184-49142206 GAGGTGGGAGAGCGGGGAGATGG - Intronic
907338738 1:53718411-53718433 TATGGCGGCAAGCGGGGGAATGG + Intronic
907380419 1:54082699-54082721 GAGGGGTGAAAGTGAGGGGAGGG + Intronic
907462284 1:54612105-54612127 TAGGGGGTATAGTGGGGGCAGGG + Intronic
907572150 1:55493168-55493190 AAGGGAGGAAAGCAGGAGGAGGG - Intergenic
907673662 1:56499075-56499097 AAGGGGGGAAGGTGGGGGGGGGG - Intronic
908374153 1:63516357-63516379 TGGGGGAGAAGGGGGGGGGAAGG + Intronic
908491920 1:64653228-64653250 AAGGGTGGAAAGCGGGACGAGGG + Intronic
909056441 1:70826494-70826516 GAGGTGGGAAAGTGGGTGGAAGG - Intergenic
910148258 1:84108323-84108345 GAGGGTGGAAGGCGGGAGGAGGG + Intronic
910731992 1:90407744-90407766 TAGGGGGAAAAGTGGGGGTGGGG + Intergenic
910820045 1:91336360-91336382 TAGGAAGGAATGCAGGGGGAGGG - Intronic
912374837 1:109201589-109201611 GAGGGCGGAAAGAGGGAGGAGGG + Intronic
912660200 1:111521002-111521024 TAGGGTGGGAAGGGGTGGGAGGG - Intronic
912708309 1:111931214-111931236 TAGGTGGGAAAGAGGTGAGAAGG + Intronic
913026999 1:114854063-114854085 GAGAGGGGAGAGCGGGGGAAGGG - Intergenic
913107661 1:115629423-115629445 TACGGGGGAGAGAGTGGGGATGG - Intergenic
914467940 1:147949198-147949220 AAGGGGGGAAAGGCGGGGAAAGG - Intronic
914717124 1:150262431-150262453 TGCCGGGGACAGCGGGGGGATGG + Intronic
915446745 1:155978481-155978503 GTTGGGGGAAGGCGGGGGGAGGG + Exonic
915725145 1:158011903-158011925 GAGGGGGAAGAGCTGGGGGAGGG - Intronic
915778856 1:158522635-158522657 TTGGGGGGCAAGGGGAGGGAGGG + Intergenic
915839081 1:159201102-159201124 GAGGGAGGAGGGCGGGGGGAGGG + Exonic
916185089 1:162123726-162123748 GACTGGGGAAAGCGGGGTGAAGG - Intronic
916214790 1:162385407-162385429 TAGAAGGGAAAGTGGTGGGAGGG - Intronic
916223510 1:162466373-162466395 AAGGGGGGAAAGGTGGGGAAAGG + Intergenic
917031879 1:170701998-170702020 GATGGGGGAAGGCGGGGGGAGGG + Intronic
917372196 1:174305906-174305928 TAGGGTGGGAGGAGGGGGGAGGG - Intronic
918158184 1:181871570-181871592 TAGGGGGAAAAGGTGGGAGAAGG + Intergenic
918620755 1:186602069-186602091 GTGGGGGGAGGGCGGGGGGACGG - Intergenic
918668873 1:187187580-187187602 GAGGGGGGAAAGCAGGAGGAGGG + Intergenic
919080317 1:192857941-192857963 AAGGGGGGAAAGGTGGGGAAAGG + Intergenic
919944337 1:202308632-202308654 TAGGAGGAAAGGCAGGGGGATGG + Intronic
920001885 1:202806773-202806795 TAAGGGAGAAAGGGGTGGGAAGG + Intronic
920787136 1:209052022-209052044 GAGGGGGGAAAGCGGGGGTGTGG - Intergenic
921133854 1:212242870-212242892 TAAGGGGAAAAGAGTGGGGAGGG - Intergenic
921300124 1:213744122-213744144 TTGGGGGGAAAGGGAGTGGAGGG + Intergenic
921339642 1:214121980-214122002 TAGTGGGGAAAGCTGGCTGAAGG + Intergenic
922416154 1:225425222-225425244 TGGGGGGGGAGGCGGGGTGAGGG + Intronic
923602067 1:235412150-235412172 GAGGGGGGAAGGGGAGGGGAGGG - Intronic
924258628 1:242207291-242207313 CAGTGGGGAAAGCGGGGAGCGGG - Intronic
924337917 1:243001591-243001613 TAGGGAGGGAAGTGGGGGGGAGG + Intergenic
1063960357 10:11301387-11301409 GAGGGGGGGAAGCGGGGGGAGGG - Intronic
1066022665 10:31319171-31319193 TGGGGGGGAAGGGGGAGGGAGGG + Exonic
1066054039 10:31663623-31663645 AAGGAGGGAAAGCAGGGGTATGG + Intergenic
1066523329 10:36247782-36247804 GAGGAGGGAAAGGGAGGGGAGGG - Intergenic
1068152031 10:53145018-53145040 GAGGGAGGAAAGGGGGGGCAAGG - Intergenic
1069059177 10:63875932-63875954 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1070050106 10:72880466-72880488 TAGAAGGCAAAGCGGGGGGGGGG + Intronic
1070363728 10:75715816-75715838 AAGGGAGGAAAGAGGAGGGAGGG - Intronic
1070369303 10:75766781-75766803 AATGGGGGAAAGGGGAGGGAGGG - Intronic
1071135102 10:82444566-82444588 GAGGGGGGAAAATGAGGGGAGGG + Intronic
1071811794 10:89190123-89190145 TGGGGGGGAAAGGGTGGGAAGGG - Intergenic
1072784243 10:98269163-98269185 TAGGGAGGAAACCGGGAGGCTGG - Intergenic
1072972408 10:100028690-100028712 TAGGAGGCAAAGCTGGGGCAGGG - Intergenic
1074890408 10:117731349-117731371 TAGGGGAGAGAGCCGGGGGATGG + Intergenic
1074977925 10:118595982-118596004 TAGGAGGGAAGGAGCGGGGAAGG + Intergenic
1075122654 10:119675775-119675797 AAGGGGGGAAGGGAGGGGGAGGG - Intronic
1077360472 11:2138357-2138379 GACGGGGCAGAGCGGGGGGATGG + Intronic
1077361150 11:2140607-2140629 TTGTGGGGAAAGCGGCTGGAGGG - Intronic
1077862120 11:6191213-6191235 TAGGGTGGGAGGAGGGGGGAGGG + Intergenic
1078992699 11:16665461-16665483 AAGGGGGGAAAACAGTGGGAAGG + Intronic
1079839670 11:25381302-25381324 TAGGGTGGGAGGAGGGGGGAGGG - Intergenic
1080268103 11:30422644-30422666 GAGGGGGGAAAGGAGGAGGAGGG + Intronic
1081006633 11:37752602-37752624 TAGTGGGGAAAACTGGGGAAAGG + Intergenic
1081969381 11:47187196-47187218 CCCGGGGGAAAGCGGGGAGAGGG - Intergenic
1083209120 11:61171703-61171725 TCTGGGGGAAAGAGGGGTGATGG - Intergenic
1084027943 11:66464515-66464537 TAGGGTGGGAGGAGGGGGGAGGG + Intronic
1084223047 11:67696709-67696731 TATGGGGCAAAGTGGAGGGATGG - Intergenic
1084246491 11:67861029-67861051 TAAAATGGAAAGCGGGGGGAGGG + Intergenic
1084477731 11:69398503-69398525 TAGGGGGGAATCCTGAGGGAGGG - Intergenic
1084579618 11:70015018-70015040 TAGGGTGGAGGCCGGGGGGATGG + Intergenic
1084626242 11:70309835-70309857 TAGGGCGGAGAGGGGAGGGAGGG + Intronic
1084630384 11:70344444-70344466 TATGGTGGGAAGCGGGAGGAAGG + Intronic
1084826188 11:71733472-71733494 TAAAATGGAAAGCGGGGGGAGGG - Intergenic
1085167509 11:74416419-74416441 TAGGGGGGAGGGTGGGGGGTTGG + Intergenic
1085318726 11:75561852-75561874 AATGGGGGAGAGCGGGGAGAAGG + Intergenic
1085533452 11:77204756-77204778 TGGGGAGGAAGGCGGGGGGCTGG - Intronic
1085707504 11:78799963-78799985 TATGGGGGTAAGGGTGGGGAAGG + Intronic
1085998214 11:81947975-81947997 GAGGGAGGGAAGCGGGGGGTGGG + Intergenic
1087795632 11:102452741-102452763 TCGGGGGGCAAGCGGCGGGAGGG - Exonic
1089303502 11:117512809-117512831 GAGGGAGGGAAGTGGGGGGAAGG - Intronic
1089581306 11:119483419-119483441 GAGGGGGGAAGGTGGGGAGAAGG - Intergenic
1090044224 11:123316866-123316888 CAGGGAGGAAGGCGGGGAGAGGG + Intergenic
1090367739 11:126221666-126221688 TAGGGGTGAATGGGGTGGGAAGG + Intronic
1090412357 11:126518083-126518105 GAGGAGGGAAAGACGGGGGAAGG - Intronic
1091707428 12:2705479-2705501 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic
1092417056 12:8298151-8298173 TAAAATGGAAAGCGGGGGGAGGG + Intergenic
1092843236 12:12562549-12562571 GAGGGGGAAAGGCGGGGGGGTGG + Intergenic
1093442421 12:19214384-19214406 GAGGAGGGAAAGAGGTGGGAGGG + Intronic
1094036393 12:26076406-26076428 TAGGGTGGGGAGCTGGGGGAGGG - Intronic
1094196324 12:27753455-27753477 TAGTGGGGATAGGGGTGGGAGGG + Intronic
1096197274 12:49656793-49656815 TGGGGAGGAAAGGGGAGGGAAGG + Intronic
1096232465 12:49904025-49904047 GTGGGGGGGAAGCGGCGGGAGGG - Intronic
1096417581 12:51426837-51426859 TAGAGGGGAAAGGGGAGAGAGGG + Intronic
1096635800 12:52958327-52958349 TAGGGGGGAAACAAGGGGGAAGG + Intergenic
1096660731 12:53122770-53122792 AAGGGGGGAAAGGTGGGGAAAGG - Intronic
1097015522 12:55984010-55984032 TAGGGGGGAGATCGGGGGCAGGG - Intronic
1097170044 12:57107639-57107661 TCGGTGGGAGAGCAGGGGGAGGG - Exonic
1098327138 12:69314991-69315013 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1098484106 12:71000867-71000889 TATGGGGGATAGCGGGGGGATGG - Intergenic
1098562432 12:71889782-71889804 GAGGGTGGAAAGTGGGAGGAGGG - Intronic
1098884076 12:75942669-75942691 AAGGGGGGAAAGGCGGGGAAAGG + Intergenic
1099047588 12:77741208-77741230 TAGAGAAGGAAGCGGGGGGAAGG + Intergenic
1100128180 12:91456233-91456255 GAGGGGGGAAAGGGAAGGGAGGG - Intergenic
1100470456 12:94888367-94888389 TGGGGGGGTTGGCGGGGGGAGGG - Intergenic
1100873895 12:98942246-98942268 GAGGTGGGGGAGCGGGGGGAGGG + Intronic
1101317715 12:103644088-103644110 AAGGGGGGAAAGGTGGGGAAAGG + Intronic
1101909421 12:108850534-108850556 TAGGGAGGAAATCTGGGGCAAGG + Intronic
1101909443 12:108850589-108850611 TAGGGAGGGGAGCTGGGGGAAGG + Intronic
1101925187 12:108965970-108965992 GAGGGAGGGAAGTGGGGGGAGGG - Intronic
1101940787 12:109097836-109097858 TAGGGGGTGAAGGGGGAGGAAGG + Intronic
1102104177 12:110306501-110306523 TGGGAGGGAAAGAGGGGCGAGGG - Intronic
1102450218 12:113036585-113036607 CAGGGGAGAAGGCGTGGGGATGG - Intergenic
1102513235 12:113429437-113429459 GAGGGGGGAATGAGGTGGGATGG + Intronic
1102677820 12:114669997-114670019 TAGGGAGCAAAGCAGGGAGACGG - Intergenic
1102683527 12:114706414-114706436 TTGGGGGAAAAGGGGAGGGAGGG - Intergenic
1102796741 12:115695495-115695517 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1103238915 12:119397805-119397827 AAGGGGGGAGGGAGGGGGGAGGG + Intronic
1105281413 13:18964867-18964889 TAGAGGAGAAAGTGGGGGGAGGG - Intergenic
1106473964 13:30081525-30081547 TTGGGGGGAAGGTGGGGGCAGGG - Intergenic
1106512291 13:30422029-30422051 GAGAGGGGAAAGCGGGGAAAGGG + Intergenic
1107122104 13:36807077-36807099 TAGGGGAGAAAGCGGAGGACAGG + Intergenic
1107819941 13:44277286-44277308 GAGGAGGGAAAGGGGAGGGAGGG + Intergenic
1108344052 13:49526928-49526950 GAGGGAGGCAAGCGGAGGGATGG - Intronic
1108748954 13:53426602-53426624 TAGAGGGGAAAGAGAGAGGAGGG - Intergenic
1110458059 13:75712137-75712159 TAGTGAGGATAGCTGGGGGATGG + Intronic
1111560337 13:89936540-89936562 TAGGGGCCAGAGCGGGGAGATGG - Intergenic
1111988917 13:95095534-95095556 TAGGGGGAAGAGTGGGAGGAGGG + Intronic
1112573361 13:100613813-100613835 TAGGGGGGAGAGGGGGAGGGAGG - Intronic
1113024292 13:105923209-105923231 TAGGGGGGAAAGGGGGGCGGGGG + Intergenic
1113954369 13:114089298-114089320 GAGGGGGGGAGGAGGGGGGAGGG + Intronic
1113975556 13:114225402-114225424 GAGGGGGGAAAGGGGAGGGGAGG + Intergenic
1115504389 14:34079344-34079366 AAGGGGGGAAAGGCGGGGAAAGG + Intronic
1117277488 14:54204459-54204481 AAGGGGGGAAAGGTGGGGAAAGG + Intergenic
1117368316 14:55052229-55052251 TAGAGGGGAAATCGGGGCCAAGG - Intronic
1117427423 14:55615375-55615397 TATGGGGGAAGGGGGAGGGACGG - Intronic
1117580187 14:57143963-57143985 TAGGAGGGGAAGTTGGGGGAGGG + Intergenic
1117731150 14:58723207-58723229 TAGGAGAGAAAGGGGAGGGAGGG - Intergenic
1118359678 14:65045399-65045421 GAGGGGGGAAGACGGGGGGTGGG - Intronic
1118538889 14:66801615-66801637 GGGGGGAGAGAGCGGGGGGAGGG - Intronic
1118678181 14:68211329-68211351 CAATGGGGAAAGCGGGTGGAGGG - Intronic
1118892195 14:69919911-69919933 CAGGGGAGAAAGGGGGGGGGGGG - Intronic
1119189730 14:72672618-72672640 TTGGAGGGAAAGCTGAGGGAAGG + Intronic
1120019642 14:79514185-79514207 TATGGTGGGGAGCGGGGGGAGGG - Intronic
1120881364 14:89417244-89417266 GAGGAGGGGAAGCGCGGGGAGGG + Intronic
1121592314 14:95125561-95125583 GAGAGGGGAAAGGTGGGGGAAGG + Intronic
1121777504 14:96600137-96600159 TAGCTGGCAGAGCGGGGGGAGGG - Intergenic
1122879877 14:104685933-104685955 TGGGTGGGTAAGTGGGGGGATGG + Intergenic
1123028561 14:105439912-105439934 CAGAGGGGGCAGCGGGGGGAAGG + Intronic
1123088556 14:105731161-105731183 AAGGGGGAAAAGCTGGAGGAGGG - Intergenic
1124035649 15:26051602-26051624 AAGGAGGGAAAGCAGGAGGAAGG - Intergenic
1124962441 15:34409055-34409077 GAGGGGGGAGAGAGGTGGGAGGG - Intronic
1124962449 15:34409073-34409095 GAGGGGGGAGAGAGGTGGGAGGG - Intronic
1124979065 15:34555277-34555299 GAGGGGGGAGAGAGGTGGGAGGG - Intronic
1124979073 15:34555295-34555317 GAGGGGGGAGAGAGGTGGGAGGG - Intronic
1125210728 15:37212316-37212338 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1125762283 15:42104872-42104894 TAGGCGGGAATATGGGGGGAGGG - Intergenic
1126370194 15:47937933-47937955 AAGGAGGGAAAGAGGGAGGAAGG + Intergenic
1126371952 15:47956641-47956663 GAGGGTGGAAAGTGGGAGGAAGG - Intergenic
1126725207 15:51624277-51624299 AAGGGAGGAAGGGGGGGGGAGGG - Intergenic
1126837341 15:52679797-52679819 GAGGGGGGGAAGGAGGGGGAGGG - Intronic
1127232426 15:57011376-57011398 TAGAAGGAAAAGCGGGGGGCAGG - Intronic
1127537380 15:59902999-59903021 GAGGGCGGAAAGTGGGAGGAGGG - Intergenic
1127757825 15:62110399-62110421 TAGGGTGGAAAGGGGTGGGTTGG + Intergenic
1127804839 15:62509813-62509835 TAGGAGGCAGAGCGGAGGGAGGG - Intronic
1128064881 15:64758398-64758420 TATGGGGGAGACCGGGGGAACGG + Intronic
1128145689 15:65331299-65331321 CCGGGGGGACAGCGGGGAGAAGG + Intronic
1128456154 15:67832519-67832541 TAGGGGTGAAAGGGGGGGCCAGG + Intronic
1128846825 15:70906045-70906067 TAGGGGAGAAAGGTGGGAGAAGG + Intronic
1129017059 15:72477915-72477937 TAGGGGGGGAAGCTGAGGCAAGG - Intronic
1129145892 15:73646829-73646851 GAGGGGGGAAAGGGAGGAGAAGG + Intergenic
1129222019 15:74136548-74136570 TAGGGGGGCGGGCGGGGGGGCGG + Exonic
1130017801 15:80201261-80201283 GAGGGGGGAAAGCGGGTTGAGGG - Intergenic
1130973040 15:88749578-88749600 TAGGAGGGAAAGTGTGAGGAAGG - Intergenic
1131449289 15:92525872-92525894 AAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1132357834 15:101185905-101185927 TATGAGGGAAAGCAGGGAGATGG - Intronic
1132399301 15:101495746-101495768 AAGGAGGGAAAGGGGGGGAAGGG + Intronic
1132399912 15:101498819-101498841 TAGGGTGGGAAGCCTGGGGACGG - Intronic
1132677432 16:1126574-1126596 GTGGGGGGAGGGCGGGGGGAGGG - Intergenic
1132734748 16:1379775-1379797 TCGGGGGGAAGGTTGGGGGAGGG - Intronic
1133013091 16:2925562-2925584 TAGGGGGAGTTGCGGGGGGAGGG + Intronic
1133022941 16:2974772-2974794 GAGGGGCGGAAGCAGGGGGAAGG + Intronic
1133392053 16:5418663-5418685 GAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1134247687 16:12552231-12552253 TAGGAGGCAAAGCTGGGGCATGG - Intronic
1134471765 16:14532604-14532626 AAGGGGGGAAAGGTGGGGAAAGG - Intronic
1134849197 16:17467153-17467175 TAGGGCGGCAGGCGGGGGGTGGG + Intronic
1135241915 16:20814844-20814866 TAGAGGGGAAATAGGGGAGAAGG - Intronic
1136619223 16:31416991-31417013 GAGGGGGGAGGGAGGGGGGAAGG - Intronic
1137603251 16:49770654-49770676 TAGGTGGGAAAGGGGAGAGAGGG + Intronic
1137614613 16:49839052-49839074 GAGGCGGGGAAGAGGGGGGATGG - Intronic
1138046392 16:53729658-53729680 TGGGGGTGAAAGCTGGGGGTTGG - Intronic
1138072644 16:54008571-54008593 AAGTGGGGAATGCAGGGGGAAGG - Intronic
1138081480 16:54094997-54095019 AAGGGGGCAAAGAGAGGGGATGG - Intronic
1138351340 16:56347767-56347789 GAGGAGGGAAAGGGAGGGGAGGG - Exonic
1138358574 16:56406077-56406099 GAGGGGGGAGAGGGGGGAGAGGG + Intronic
1138594653 16:58023327-58023349 TGGAGGGGAGAGCTGGGGGAGGG + Intergenic
1138649657 16:58452184-58452206 TAGGGAGGCAAGCTGTGGGAGGG + Intergenic
1139239739 16:65378631-65378653 TCGGGGAGAAAGGGTGGGGAGGG - Intergenic
1139529969 16:67538029-67538051 GGGGGGGGAAATCGGGGGCAGGG + Intronic
1139771369 16:69280299-69280321 AAGGGGGGAAAGGTGGGGAAAGG - Intronic
1140185138 16:72762938-72762960 TAGGGAGAAAAGTGAGGGGAGGG - Intergenic
1140354771 16:74296545-74296567 TTGGGGGGGTGGCGGGGGGAGGG + Intergenic
1140545342 16:75802653-75802675 GAGGGTGGAGGGCGGGGGGAGGG - Intergenic
1141999904 16:87658352-87658374 GAGGGGGAGAAGCGGGGAGAAGG - Intronic
1142008223 16:87700511-87700533 GAGGGAGGAAAGAGGGTGGAGGG + Intronic
1142145203 16:88489986-88490008 GAGGAGGGACAGCGTGGGGAGGG + Intronic
1142511951 17:401702-401724 TAGAGGGGAATGGCGGGGGATGG - Intergenic
1142879608 17:2874237-2874259 GAGGGGAGAAAGGGGAGGGAGGG - Intronic
1143512667 17:7405010-7405032 TAGGAGGGAAGGCGGGGGTGAGG - Intronic
1143534218 17:7526325-7526347 GAGGGGAGAAAGAGGGGAGATGG - Intergenic
1143727155 17:8856987-8857009 CTGTGGGGAAAGCTGGGGGAAGG - Intronic
1144481115 17:15629838-15629860 TCGGGGGTAAAGCAGGGGGCTGG - Intronic
1144917194 17:18733899-18733921 TCGGGGGTAAAGCAGGGGGCTGG + Intronic
1145022411 17:19441965-19441987 AAGGGGGGAAAGGCGGGGAAAGG + Intergenic
1145193736 17:20868964-20868986 ATGGGGGAAAAGGGGGGGGAAGG + Intronic
1145757480 17:27403343-27403365 TAGAGTGGAAAGCGGGGGAAGGG - Intergenic
1146145674 17:30414068-30414090 TAGGAAGGAAAGCTGGGTGATGG + Intronic
1146824884 17:36013551-36013573 CAGGGGGAAAAGGGTGGGGAAGG - Intronic
1146928569 17:36762054-36762076 TGGGGGAGAAGGCAGGGGGAGGG + Intergenic
1146944526 17:36864717-36864739 GAGGAAGGAAAGGGGGGGGAGGG - Intergenic
1146944537 17:36864739-36864761 GAGGAAGGAAAGGGGGGGGAGGG - Intergenic
1147256066 17:39183060-39183082 TAGAGGGGAAATCGGTAGGAAGG - Intronic
1147360009 17:39924528-39924550 TAGGGGGTGAGGCTGGGGGATGG - Intronic
1147463451 17:40591067-40591089 TATGGGGGAAAGAGGATGGATGG - Intergenic
1147588187 17:41665186-41665208 TGGGGGGGACAGTGGGGAGAGGG - Intergenic
1147608760 17:41789078-41789100 TAGGGAGGTAAGCTGGAGGATGG - Intergenic
1147924519 17:43938433-43938455 GAGGGAGGAAAGCGGGGGGTGGG + Intronic
1147980835 17:44272948-44272970 CAGGCGGGAGAGCTGGGGGATGG + Intergenic
1148269522 17:46252811-46252833 AAGGGGGGAAAGGTGGGGAAAGG - Intergenic
1148460951 17:47838708-47838730 TAGAGGGGGAAGCTGTGGGAGGG + Intronic
1148502325 17:48101230-48101252 GAGGCGGGAGAGCTGGGGGAGGG - Intronic
1149038124 17:52157815-52157837 TCGACGGGAAAACGGGGGGAAGG + Exonic
1149515593 17:57278628-57278650 TTGGGGGGGCAGTGGGGGGATGG - Intronic
1149658145 17:58320855-58320877 TAGGGGGGAAACTGGGAGGATGG - Intronic
1150172616 17:63015458-63015480 TGGGGTGGGAAGCGGGGGGAGGG - Intronic
1150370258 17:64631259-64631281 TGGGGGGGAGAGAGGGGGGGGGG + Intronic
1150480267 17:65503789-65503811 TGGAGGGCAAAGCGGGGAGAGGG + Intergenic
1152209588 17:78996010-78996032 TAGGGAGGAAAGCGGGGTACAGG - Intronic
1152879092 17:82805216-82805238 TAGAGGGGGAAGTGGGGGCATGG + Intronic
1153565462 18:6414241-6414263 AAGGGCAGAAAGCGGGTGGAGGG + Intronic
1153571680 18:6479453-6479475 TAGGGTGGAAAGAGGTAGGAGGG + Intergenic
1153910348 18:9701405-9701427 TGGGGGAGGAAGCGGGGAGAAGG - Intergenic
1153939893 18:9968611-9968633 TAGAGGGGGAAGCGGGGTCAGGG - Intergenic
1154099434 18:11456196-11456218 TAGGGTGGGAGGAGGGGGGAGGG + Intergenic
1155392441 18:25350870-25350892 GATGGGGGAAAGCGGGGAGCAGG + Intronic
1156199871 18:34818461-34818483 TAGGGTGGAGAGTGGGAGGAAGG - Intronic
1156327761 18:36089647-36089669 TAGGGGGAAGAGGGGAGGGAGGG + Intergenic
1157606671 18:48930301-48930323 TAGGGGTGAAAGGGCTGGGATGG - Intronic
1157695622 18:49720942-49720964 TGGGGTGGGAGGCGGGGGGAGGG + Intergenic
1157705380 18:49800453-49800475 AAGGGGGGAAAGGTGGGGAAGGG + Intronic
1158959739 18:62579665-62579687 TAGTGGGGGAAGGGGAGGGAGGG - Intronic
1159573289 18:70144595-70144617 TATGGAGGAAGGCGGGGAGAGGG - Intronic
1159612386 18:70540347-70540369 TTGGGGGGAAAGGGTGGGGGAGG - Intergenic
1159966186 18:74598085-74598107 GAGGGGCGGAGGCGGGGGGAGGG - Intronic
1160130263 18:76218942-76218964 CATGGGGGAAAGCAGGGAGAGGG + Intergenic
1160186613 18:76681052-76681074 AATGGGGGAAAGTGGGGGGGAGG - Intergenic
1160779541 19:871778-871800 GAGAGGGGAGAGCGGGGAGAAGG + Intronic
1160779553 19:871810-871832 GAGAGGGGAGAGCGGGGAGAGGG + Intronic
1160779559 19:871826-871848 GAGAGGGGAGAGCGGGGAGAGGG + Intronic
1160902424 19:1435011-1435033 TGGGGGGGGGGGCGGGGGGAGGG + Exonic
1160919227 19:1512082-1512104 GCAGGGGGAAAGAGGGGGGAAGG + Intronic
1161100329 19:2418467-2418489 TAGGGAGGGAAGGGGAGGGAGGG - Intronic
1161100414 19:2418694-2418716 TAGGGAGGGAAGGGGAGGGAGGG - Intronic
1161100442 19:2418767-2418789 TAGGGAGGGAAGGGGAGGGAGGG - Intronic
1161401483 19:4067625-4067647 TAGGGGCGTCAGCGGGGGAAGGG + Intergenic
1161433937 19:4250665-4250687 TAGGAGGGGAAGAGGGGGGTGGG + Intronic
1161505011 19:4639303-4639325 ACGGGGGGGAAGTGGGGGGAAGG - Intergenic
1161790403 19:6356028-6356050 AAGGGGGGAAAGGCGGGGAAAGG + Intergenic
1162594013 19:11613140-11613162 GAGGGGGGGAAGGGAGGGGAGGG - Intronic
1162717148 19:12641359-12641381 TGGCGGGGAAAGCAGGGGGAAGG - Intergenic
1163004601 19:14389329-14389351 GAGGGGGGAAGGGGAGGGGAAGG + Intronic
1163093821 19:15041287-15041309 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1163518797 19:17779951-17779973 ATGGGGGGAGAGCGGCGGGATGG + Intronic
1164301700 19:23967769-23967791 TAGGGTGGAAAGTGGAGGGCAGG + Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165939117 19:39406626-39406648 GAGCGGGGAATGCGTGGGGAAGG - Intergenic
1165965311 19:39572945-39572967 TTGGGGGGAAAAGGGAGGGAAGG - Intergenic
1166068387 19:40373588-40373610 AAGGGGGGGAAGCGGGGGAGCGG + Intronic
1166695418 19:44848917-44848939 CAGGGAAGAAAGCTGGGGGAGGG - Intronic
1166698876 19:44870352-44870374 CAGGGGAGAAGGCGGTGGGAAGG + Intronic
1167109086 19:47448247-47448269 GAGGGGGAAGAGCGGGGTGAGGG + Intronic
1167199843 19:48056981-48057003 TTGGGTGGAGAGCGGGAGGAAGG + Intronic
1167324091 19:48813350-48813372 TGGGGAGAAAAGAGGGGGGAAGG + Intronic
1167598227 19:50438407-50438429 TAGGTGGGGAAGCGGATGGATGG + Intronic
1167612218 19:50513016-50513038 GAGAGGGGAAAGAGGGCGGAGGG + Intronic
1168230400 19:55027319-55027341 TAGGTGGGAAAGAAGTGGGAGGG - Intronic
1168257153 19:55173353-55173375 TGGGGTGGAAGGTGGGGGGAGGG + Exonic
1168320514 19:55506826-55506848 TAGGGAGCAAAGCAGGGGAAGGG + Intronic
1168557825 19:57358239-57358261 TAGGGGGTGAAGTGGGGGGGGGG - Exonic
925046045 2:773789-773811 TTGGGGGGCAGGCTGGGGGACGG - Intergenic
925379367 2:3414543-3414565 CAGCGGGGACAGCTGGGGGATGG - Intronic
926972047 2:18475937-18475959 GAGGAGGGAAGGCGGGGGAAGGG + Intergenic
927742806 2:25587575-25587597 TCAGTGGGGAAGCGGGGGGAAGG + Intronic
927926822 2:27019342-27019364 GAGGGAGGATGGCGGGGGGATGG + Intronic
928009664 2:27595132-27595154 GAGGGAGGAGAGCGGGGAGAGGG + Intronic
928529137 2:32172941-32172963 TAGGAGGGAAGGCGGAGTGATGG - Intronic
928715073 2:34050887-34050909 TTGGGGGGGAGGTGGGGGGACGG + Intergenic
929071180 2:38032239-38032261 TAGGTGGGAGAGTGAGGGGAAGG - Intronic
929110851 2:38403937-38403959 AAGGGGGGAAAGGCGGGGAAAGG + Intergenic
930134821 2:47891285-47891307 CAGGGGTGAAAGGGAGGGGAGGG - Intronic
930730368 2:54723423-54723445 TAGGGCGGACAGCGCGCGGAAGG - Intergenic
930927123 2:56831815-56831837 TAGGAGGGAGAGGGGTGGGAGGG + Intergenic
931340766 2:61398566-61398588 AAGAGGGGAAAGTCGGGGGAGGG + Intronic
931355652 2:61536639-61536661 TCGGGTGGGAAGCGAGGGGAGGG - Intronic
931420837 2:62125915-62125937 TCGGGGGTGAAGTGGGGGGAAGG - Intronic
932132714 2:69202106-69202128 TAGAGGGGAAACCAGGGAGAGGG + Intronic
932372758 2:71206353-71206375 TAAGAGGGAAAGTGGGGTGAAGG - Intronic
932692959 2:73929108-73929130 AAGGAGGGGAAGCGAGGGGAGGG - Intronic
932920874 2:75914213-75914235 GAGGGTGGAAGGCGGGAGGAGGG - Intergenic
933721161 2:85398586-85398608 GAGGGGAGAAGGCAGGGGGAAGG - Intronic
933758880 2:85661201-85661223 TTGGGGGGGAAGCTGGGGGTTGG + Intronic
936043863 2:109171457-109171479 TAGGGGGGCAAGCGTGGAGCAGG - Intronic
936989979 2:118352993-118353015 GAGTGGGGAAAGTGGGAGGATGG - Intergenic
937136689 2:119559465-119559487 TAAGGGGGAAAGTGGGGACATGG + Intronic
939095479 2:137828738-137828760 TAGGTGGGAAAGGCGGAGGAGGG - Intergenic
940651325 2:156443805-156443827 TAGGTGGGTAAGTAGGGGGAAGG - Intronic
941095792 2:161238518-161238540 TAGGAAGGAAAGCGGGGGGAGGG + Intergenic
941232898 2:162933287-162933309 TAGGTGGGATAGCAGGGTGATGG - Intergenic
941809193 2:169738873-169738895 TAGGGAGGAGAGGGAGGGGAAGG - Intronic
942276323 2:174326540-174326562 CAGGCGGGAAAGCGGGGGCGGGG - Intergenic
942332929 2:174847592-174847614 TAGCAGGGAAGGTGGGGGGAAGG + Intronic
942560375 2:177212875-177212897 TTAGGGGGAGAGCGGGGGGTTGG + Intronic
942890425 2:180980859-180980881 GGGGGGGGGAAGGGGGGGGAGGG - Exonic
943025181 2:182619050-182619072 TAGGCGGGTGAGCGGGGGCAGGG + Intergenic
944154843 2:196598176-196598198 GAGAGGGGAAAGAGAGGGGAAGG + Intergenic
944154959 2:196598406-196598428 AAGGGGGGAAAGGAAGGGGAGGG + Intergenic
945155226 2:206830931-206830953 TAGGGGGGAAAGTAAGGGGTTGG - Intergenic
945579971 2:211581110-211581132 TCAGGGGGAAAGGGTGGGGAGGG + Intronic
945613068 2:212030316-212030338 TAGGGGAGAAAGTGGTGGTAAGG - Intronic
946068737 2:217012728-217012750 GATGGGGGAAAGCTGGGGGACGG - Intergenic
947634018 2:231671121-231671143 TGGGGGGGAATGGGAGGGGATGG + Intergenic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
948197793 2:236108126-236108148 TAGGGGGTCAGGCGGAGGGACGG - Intronic
948460253 2:238125611-238125633 CAGGGGTAAAAGCGGGGAGACGG + Intronic
948927484 2:241108578-241108600 CAGAGGGGGGAGCGGGGGGAGGG + Intronic
949060345 2:241953230-241953252 AAGGGGGGAGAGGGAGGGGAAGG + Intergenic
1169043068 20:2511719-2511741 CAGGGAGGAAAGCAGGGCGAGGG - Intronic
1169137102 20:3203949-3203971 ATGGGGGGAAAGAGGGAGGATGG + Intronic
1169155628 20:3327364-3327386 GAGTGGGGAAAGATGGGGGAGGG + Intronic
1169189184 20:3646521-3646543 TGGAGGGGAAGGCGGAGGGAGGG + Intronic
1170664028 20:18370186-18370208 TGGGGGGGGGGGCGGGGGGAGGG + Intergenic
1170862601 20:20122097-20122119 TTGGGGGGAAAGCTGGGAGGGGG - Intronic
1171151431 20:22829501-22829523 GAGGGGAGAGAGCGGGAGGAGGG - Intergenic
1171365178 20:24618086-24618108 TAGGGGGGAACCCGGGGAGTGGG + Intronic
1171365186 20:24618102-24618124 GAGTGGGGAAAGCCCGGGGAGGG + Intronic
1171365290 20:24618353-24618375 GAGGGGGGAGAGCCTGGGGAAGG + Intronic
1171370866 20:24661303-24661325 GAGGGAGGAAAGGGGAGGGAGGG + Intronic
1172022091 20:31921823-31921845 TGGGGTGGAAGGAGGGGGGAGGG + Intronic
1172874246 20:38154735-38154757 TTGGGGGGAGGGCTGGGGGAGGG - Intronic
1173162845 20:40664908-40664930 TTGGGGGGAAGGCGGGGGAGGGG + Intergenic
1173366800 20:42393175-42393197 CAGGGGAGAAGGCTGGGGGAAGG + Intronic
1173486974 20:43448292-43448314 GAGGGGAGAAAGCAGGGAGAGGG + Intergenic
1174022353 20:47541322-47541344 GAGTGGGGAAAGGAGGGGGAGGG - Intronic
1175491686 20:59384391-59384413 TGGGGAGGAAGGTGGGGGGAAGG + Intergenic
1175831604 20:61967700-61967722 GAGGGGGAAAAGGGAGGGGAGGG - Intronic
1176289864 21:5038084-5038106 GAGGGGGGACAGTGGGGAGAGGG - Intronic
1176549427 21:8214849-8214871 GAGGGGGGAGAGCGCGGCGACGG - Intergenic
1176557322 21:8259078-8259100 GAGGGGGGAGAGCGCGGCGACGG - Intergenic
1176568355 21:8397883-8397905 GAGGGGGGAGAGCGCGGCGACGG - Intergenic
1176576264 21:8442113-8442135 GAGGGGGGAGAGCGCGGCGACGG - Intergenic
1179083657 21:38196939-38196961 TTGGGGGGAAAGGGTGGGAAGGG - Intronic
1179116678 21:38499723-38499745 AAGGGGGGAAAGGGAGAGGAAGG + Intronic
1179372749 21:40821861-40821883 AAGGGTGGAAAGTGGGAGGAGGG + Intronic
1179810127 21:43865044-43865066 CGGGGGGGGACGCGGGGGGACGG - Intergenic
1179867387 21:44225555-44225577 GAGGGGGGACAGTGGGGAGAGGG + Intronic
1180736771 22:18023494-18023516 TAGGGAGGAGAGAGGAGGGAAGG + Intronic
1181021690 22:20106888-20106910 CAGGGGTGACAGCGGGGGAAAGG - Intronic
1181538536 22:23560915-23560937 AAGGGGGGAAAGGCGGGGAAAGG - Intergenic
1182941588 22:34282235-34282257 TGGTGGGGAGAGCGGGGGGGCGG - Intergenic
1183880044 22:40819400-40819422 GGGGCGGGAAAGCGGGGGGGGGG + Intergenic
1184037845 22:41926832-41926854 TCGGGGAGGAAGCGGGGGGCGGG + Intergenic
1184042690 22:41953348-41953370 TGGGGAGGAAAGCAGGGGGATGG - Intergenic
1184177373 22:42795900-42795922 CAGGGGGGAGACCGAGGGGAAGG + Intergenic
1184437607 22:44488927-44488949 CAGGGGAGAAAGGGGAGGGAGGG + Intergenic
1184760001 22:46538442-46538464 TACGGAGGACAGCGGGGGGCGGG + Intergenic
1184822619 22:46921230-46921252 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
1203254314 22_KI270733v1_random:131171-131193 GAGGGGGGAGAGCGCGGCGACGG - Intergenic
1203262370 22_KI270733v1_random:176250-176272 GAGGGGGGAGAGCGCGGCGACGG - Intergenic
949287498 3:2424206-2424228 TAGGGTGGAGGGAGGGGGGAGGG - Intronic
949899326 3:8796848-8796870 TTGGGGGGAAAGGGTGGGAAAGG + Intronic
950029527 3:9843299-9843321 TAGGGTTAAAAGCGGGGAGAGGG + Intronic
950089053 3:10281984-10282006 TCTGGGGGGAGGCGGGGGGAGGG - Intronic
950598709 3:14011292-14011314 TTGGGGGAAAAGAGGGGGAAAGG - Intronic
950819667 3:15742932-15742954 AAGGGGGGAAAGGCGGGGAAAGG + Intronic
950837735 3:15936626-15936648 TGGGGGGGTAAGTGGGTGGAAGG - Intergenic
950848432 3:16038032-16038054 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
951269539 3:20607941-20607963 CAGGGGGTAAAACAGGGGGAAGG + Intergenic
951534521 3:23729035-23729057 AATGGGGGAAAGCTGGGGGAGGG - Intergenic
952113541 3:30153098-30153120 TAGGGTGGGAGGCTGGGGGAGGG - Intergenic
952467737 3:33608528-33608550 TGGGGAGGAAAGTGGGAGGAAGG + Intronic
953726019 3:45399778-45399800 AAGGGTGGAAAGGGGGGTGAAGG - Intronic
954411795 3:50374202-50374224 GAGGGGGGAAGGTGAGGGGAGGG + Intronic
955670234 3:61394384-61394406 GAGGGGGAAAAGGAGGGGGAGGG + Intergenic
956681671 3:71786488-71786510 TGTGGGGGATAGCGGGGGGAAGG + Intergenic
956697274 3:71929102-71929124 AAGGGGGGAAAGGCGGGGAAAGG + Intergenic
956741440 3:72279279-72279301 AAGGAGGGAAAGTGAGGGGAGGG + Intergenic
957561362 3:81826065-81826087 TAGGGAGGAAAGGGAGGAGATGG - Intergenic
957778701 3:84790168-84790190 TAGGGGGAAAAGCTAGGGTATGG - Intergenic
958184056 3:90096998-90097020 TAGGGTGGGGAGCTGGGGGAGGG - Intergenic
959191589 3:103119307-103119329 TGGGAGGGAAAGCTGGGGGAGGG + Intergenic
959586007 3:108026103-108026125 AAGGGGGGAAAGGCGGGGCAAGG - Intergenic
960638975 3:119809558-119809580 CGGGGGGGAAGGCGGGGGGGTGG + Intronic
960677109 3:120205848-120205870 TATTGGGGAAAGCTGGGCGAAGG - Intronic
961175855 3:124834541-124834563 GAGGGGAGGGAGCGGGGGGAGGG + Intronic
961422411 3:126816853-126816875 TGGGGTGGGAAGAGGGGGGAGGG - Intronic
961612583 3:128152922-128152944 CGGGGGGGAGGGCGGGGGGACGG - Intronic
961894604 3:130156753-130156775 TAAAATGGAAAGCGGGGGGAGGG + Intergenic
962032880 3:131619881-131619903 TAGAGAGGAAAGGGGAGGGATGG + Intronic
962202800 3:133414787-133414809 TAGAGGGGTAAGCGGGGGGGGGG - Intronic
962212708 3:133492193-133492215 TAGGGGGGAAAATGGGGGCTGGG - Intergenic
962311333 3:134329143-134329165 AAGGGAGGAAAGGGAGGGGAGGG - Intergenic
962997006 3:140639880-140639902 GAGGGGGGAGAGTGGGAGGAGGG - Intergenic
963632065 3:147745757-147745779 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
963924294 3:150935285-150935307 TGGGGTGGGAAGAGGGGGGAGGG - Intronic
964625605 3:158756065-158756087 TAGGGGGCAAAGGGGTGAGAGGG - Intronic
964915826 3:161839945-161839967 TGGGGGGAAGAGTGGGGGGAGGG - Intergenic
965033558 3:163405351-163405373 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
966172201 3:177094814-177094836 TAGGGGGAAAGGGTGGGGGATGG + Intronic
966181983 3:177196906-177196928 GAGAGAGGAAAACGGGGGGATGG + Intronic
967327010 3:188251006-188251028 AAGGGGGGAGGGCGGGGGGGAGG - Intronic
967884119 3:194321840-194321862 TGGGGTGTACAGCGGGGGGAGGG + Intergenic
968001569 3:195210117-195210139 TTGGGGTGAAGGCTGGGGGAGGG - Intronic
968752405 4:2396825-2396847 GAGGGCGGACAGCTGGGGGAGGG + Intronic
968789180 4:2647675-2647697 AGGGGTGGGAAGCGGGGGGAGGG - Intronic
969004701 4:4009845-4009867 TAAAATGGAAAGCGGGGGGAGGG + Intergenic
969342139 4:6548933-6548955 TAAGAGGGAAGGCGGGGAGAGGG - Intronic
969363586 4:6681031-6681053 TCTGGGGGAAAGCAGGGAGAGGG - Intergenic
969436925 4:7193808-7193830 TAGCCGGGAAGGTGGGGGGAGGG - Intronic
969582119 4:8071623-8071645 TAGGGGGCAAAACGGGGGTGGGG + Intronic
969809194 4:9634862-9634884 TAAAATGGAAAGCGGGGGGAGGG - Intergenic
970310381 4:14776712-14776734 TAAGGGGGAAGGCTGGGCGAGGG - Intergenic
970426665 4:15952470-15952492 TCAGGGGGAAAGCGTTGGGAGGG - Intergenic
970530028 4:16971995-16972017 AAATGGGGAAAGTGGGGGGAAGG + Intergenic
970983548 4:22129145-22129167 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
972336508 4:38111672-38111694 TAGTAGGAAAAGCAGGGGGAGGG + Intronic
972358930 4:38308906-38308928 AAGGGGGAAAAGGGAGGGGAGGG - Intergenic
973244893 4:48000729-48000751 CAGTGGGGGAAGCGGGGGGGTGG + Intronic
973563976 4:52165344-52165366 GAGGGGGGAGGGTGGGGGGAGGG - Intergenic
974330229 4:60468268-60468290 TGGGGTGGAAGGAGGGGGGAGGG + Intergenic
974925918 4:68297136-68297158 GAGGGTGGAAGGCGGGAGGAGGG - Intergenic
975036762 4:69694242-69694264 TAGGGTGGAGGGAGGGGGGAGGG - Intergenic
975042617 4:69762544-69762566 AAGGGGGGAAAGGTGGGGAAAGG + Intronic
975786966 4:77900990-77901012 TAGGGGGTAAGGGAGGGGGAAGG + Intronic
975848560 4:78548608-78548630 AAGGGGGGAAAGGTGGGGAAAGG + Intergenic
977081949 4:92541143-92541165 TAGGGTGGGGAGAGGGGGGAGGG + Intronic
979679831 4:123447344-123447366 GAGGAGGGAAAGGGAGGGGAGGG - Intergenic
979750146 4:124269511-124269533 TAGGGTGGAAGTCTGGGGGAGGG - Intergenic
980025135 4:127757274-127757296 CAGGGAGGAAAGTGGGGGAAGGG - Intronic
980562978 4:134501948-134501970 AAGGGGGGCAGGCGGGGGGCTGG - Intergenic
981011828 4:139933155-139933177 AAGGAGGGAAAGAGTGGGGAAGG + Intronic
981736060 4:147951443-147951465 TAGGGGGAAAAGGAGAGGGAGGG + Intronic
981986858 4:150867945-150867967 TCGGGGGGAAAGGGAGGGGCAGG - Intronic
983503146 4:168523264-168523286 AAGGGAGGAAGGAGGGGGGAGGG + Intronic
983522074 4:168719721-168719743 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
984004655 4:174294481-174294503 AAGGGGGGAAAGGCGGGGAAAGG - Intronic
984408599 4:179366590-179366612 GGGGGGGGGCAGCGGGGGGATGG - Intergenic
984716106 4:182926729-182926751 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
984815369 4:183831128-183831150 GAGGGGGGATGGTGGGGGGATGG + Intergenic
985324145 4:188748704-188748726 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
985781484 5:1874082-1874104 GAGGGGGCAAAGCGGGGGGGGGG - Intergenic
987096605 5:14556087-14556109 AAGTGGGGGAAGCGGGGGGGTGG + Intergenic
987498738 5:18678447-18678469 TAGGGGAGGAGGCTGGGGGAAGG - Intergenic
989011425 5:36876820-36876842 GGGGGGGGAGGGCGGGGGGAAGG - Exonic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989988748 5:50735864-50735886 TGGGGGTGGAAGCTGGGGGAGGG + Intronic
990336966 5:54783844-54783866 GAGGGGGGAGAGTGGGAGGAGGG + Intergenic
990643164 5:57811036-57811058 TAGGGTGGGGAGAGGGGGGAGGG + Intergenic
990817352 5:59800607-59800629 TAGGGGGGTAGGGGTGGGGAGGG - Intronic
991373466 5:65940873-65940895 AAGGGGGGAAAGGCGGGGAAAGG + Intronic
991432422 5:66562329-66562351 TAGGGGGGAAAGAGAGGGTGGGG - Intergenic
991723364 5:69514962-69514984 AAGGGGGGAAAGGCGGGGAAAGG - Intronic
992351123 5:75930158-75930180 CAGGGGGAGAAGCGGGGGAAGGG - Intergenic
992361604 5:76044056-76044078 TTGGAGGGAGAGCAGGGGGAGGG - Intergenic
994559828 5:101353541-101353563 AAAGGGGGAAGGTGGGGGGAGGG + Intergenic
994869691 5:105331647-105331669 GAGGGAGGAAAGAGGAGGGAGGG + Intergenic
994954448 5:106510244-106510266 AAGGAGGGAAAGGGAGGGGAAGG - Intergenic
995815111 5:116158498-116158520 TGAGGGAGAAAGGGGGGGGAGGG - Intronic
995923168 5:117338395-117338417 TGGGGTGGAGGGCGGGGGGAGGG - Intergenic
995942131 5:117599415-117599437 AAGGGGGGAAAGGCGGGGAAAGG - Intergenic
995991590 5:118246645-118246667 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
996276932 5:121678177-121678199 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
996562752 5:124848711-124848733 TAGGGAGGAAGGTGGGGGAAAGG - Intergenic
998142064 5:139705656-139705678 CTGGGGGGAAAGAGAGGGGAGGG - Intergenic
998392065 5:141793583-141793605 TAGGAGGGGAAGGGTGGGGAGGG - Intergenic
999143342 5:149377150-149377172 GAGGAGGGAGAGCTGGGGGATGG - Intronic
999853571 5:155569098-155569120 TAGAGGGGAAAGGGAGGGAAAGG - Intergenic
1000687130 5:164264836-164264858 GTGGGGGGAAAGGTGGGGGAAGG + Intergenic
1001785922 5:174413013-174413035 TTGGGGGAAAGCCGGGGGGAAGG + Intergenic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002888808 6:1317062-1317084 GAGGGGGGTGGGCGGGGGGAGGG - Intergenic
1003094765 6:3133533-3133555 GGGAGGGGAAAGTGGGGGGAGGG - Intronic
1003297890 6:4849925-4849947 TTGGGGGGAAAGGGTGGGGAGGG + Intronic
1003330595 6:5125289-5125311 GAGGGAGGAGAGCTGGGGGAGGG - Intronic
1003636532 6:7836555-7836577 TATGGGGGGAAGCTGGGTGAAGG + Intronic
1003673473 6:8181405-8181427 AGGGAGGGAAAGAGGGGGGAGGG - Intergenic
1004335585 6:14761660-14761682 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1004414727 6:15415252-15415274 AAGGGGGGAAAGGTGGGGAAGGG - Intronic
1004664029 6:17735107-17735129 AAGGGGGGAAAGACGGGGAAAGG - Intergenic
1006092783 6:31637640-31637662 TAAGGGGGAAAGGGGTGGGCGGG + Exonic
1006263171 6:32894167-32894189 AAGAGGGGAAAGAGGGGGAAGGG - Intergenic
1007406226 6:41637713-41637735 TCGGGGAGAAAGGGGAGGGAGGG - Intronic
1008416237 6:51244068-51244090 CAGGGGGGAAAGGGTGGGAAGGG + Intergenic
1008504160 6:52212794-52212816 CAGAGGGGAAAGCGGGAGTAGGG + Intergenic
1009304403 6:62070480-62070502 TAGGGTGGGAGGAGGGGGGAGGG - Intronic
1009507118 6:64498610-64498632 GTGGGGGGAAAGGGGAGGGAGGG - Intronic
1009779420 6:68250749-68250771 GAGGGGTGGAAGCGGGGTGAGGG - Intergenic
1011154881 6:84319791-84319813 TGGGGTGGGAAGCTGGGGGAGGG + Intergenic
1011204729 6:84879360-84879382 TTGGGTGGAGGGCGGGGGGAGGG - Intergenic
1011632362 6:89339597-89339619 GAGGGGGGAAGGAGAGGGGAGGG + Intronic
1011656297 6:89555085-89555107 GAGGGGGGAGAGAGGGGGGAGGG - Intronic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1011854325 6:91669761-91669783 CAGTGGGGAAAGAGAGGGGAGGG + Intergenic
1012085581 6:94822296-94822318 AAGGGGGGAAAGAGGGGGGAAGG - Intergenic
1013681190 6:112528099-112528121 AAGGGGGGAAAGGCGGGGAAAGG - Intergenic
1013682110 6:112535835-112535857 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1014107335 6:117582252-117582274 TAGGGGGGGAGGCAGAGGGAGGG - Intronic
1015212983 6:130719042-130719064 TCGGGAGGAAGGCGGGAGGAGGG + Intergenic
1015591461 6:134826701-134826723 GAAGGGGGAAAGAGGGGGGAGGG + Intergenic
1015821954 6:137270917-137270939 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1015842998 6:137493304-137493326 GAGGAGGGAGAGCGGCGGGAGGG - Exonic
1016400740 6:143677864-143677886 AGGAGGGGGAAGCGGGGGGAGGG - Intronic
1017384935 6:153872429-153872451 TTGGGGGGGGGGCGGGGGGATGG - Intergenic
1017751061 6:157490986-157491008 TAGGGAGGGAAGGGGGAGGAGGG + Intronic
1017931910 6:158963402-158963424 GAAGGGGGAAGGAGGGGGGAGGG - Intergenic
1019268323 7:131558-131580 CAGGAGGGAAAGGGAGGGGAGGG + Intergenic
1020324835 7:6966330-6966352 TAAAATGGAAAGCGGGGGGAGGG + Intergenic
1021894350 7:25220191-25220213 TGGGGTGGAAAGCAAGGGGAAGG - Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022325004 7:29323147-29323169 TTGGGGGGGAACGGGGGGGACGG - Intronic
1022493916 7:30841199-30841221 GAGGGGAGATAGCGTGGGGAGGG - Intronic
1022661728 7:32374059-32374081 TAGGCAGGAAAGAGGGAGGAGGG + Intergenic
1022897817 7:34770600-34770622 TAGGCTGGAAAATGGGGGGAGGG + Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023791596 7:43758001-43758023 TAGGGGAGAAAACAGGGAGAGGG - Intergenic
1024152426 7:46585982-46586004 TAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1024309972 7:47959926-47959948 AAGGGGGGAAAGGCGGGGAAAGG + Intronic
1024539049 7:50460606-50460628 AAGGGGGGAAAGGCGGGGAAAGG + Intronic
1025997889 7:66539605-66539627 TAAAGGGGAAAGAGGGGGGCTGG + Intergenic
1026308767 7:69166144-69166166 AAGAGGGGAAAGGGGGGGGAAGG + Intergenic
1026511695 7:71032849-71032871 TTGGGGGGAAAGCATGGGAAGGG + Intergenic
1026930207 7:74219635-74219657 GAGGAGGGAAAGCAGAGGGACGG - Intronic
1027189383 7:75988681-75988703 TTGGGGGGAAAGCCGGGTGGAGG + Intronic
1027222660 7:76223910-76223932 GAGGGGGGCAAGTTGGGGGAGGG - Intronic
1027476097 7:78633241-78633263 GAGGGCGGAAGGCGGGAGGAGGG + Intronic
1028254621 7:88578665-88578687 TAGGGTGGAATGAGGTGGGAAGG - Intergenic
1028985474 7:97005657-97005679 AAGGGGGGAAAGCAGGCGGGGGG + Exonic
1028988555 7:97026230-97026252 TAGGAGGGAAAACGGAGGGGAGG - Intergenic
1029347972 7:99992599-99992621 CAGCGGGGAGAGCGGGTGGAAGG - Intergenic
1029372678 7:100159208-100159230 GAGGGTGGAAAGGGGAGGGATGG - Intergenic
1029390458 7:100271275-100271297 TTGGGGGGGAAACGGGGGGTAGG - Intronic
1029412915 7:100427025-100427047 GAGGGAGGAAAGGGGAGGGAGGG - Intronic
1029557552 7:101280809-101280831 CAGGGAGGAAAGGGGGTGGAAGG + Intergenic
1029584776 7:101463512-101463534 AAGAGGGGGAAGAGGGGGGAAGG - Intronic
1029707049 7:102281734-102281756 TAGGGTGGCAAGGGGAGGGAAGG - Intronic
1030530412 7:110705731-110705753 GAAGGGGGAAAGGGAGGGGAAGG - Intronic
1030759734 7:113335609-113335631 TAGGGAGAAAAGCGGGGGTATGG + Intergenic
1030779937 7:113587864-113587886 TAGTGGGGAAGGCTGGGGTAGGG - Intergenic
1030880790 7:114876491-114876513 TAGTGGGGGAAGCAGGGTGAGGG - Intergenic
1031595060 7:123640636-123640658 GAGGGGGGAGAGGAGGGGGAGGG + Intergenic
1031595070 7:123640654-123640676 GAGGGGGGAGAGGAGGGGGAGGG + Intergenic
1031612002 7:123839127-123839149 GAGGTGGGAGAGCTGGGGGAGGG - Intronic
1032042663 7:128576448-128576470 AAGGGGGGAAAGGCGGGGAAAGG - Intergenic
1032215394 7:129953106-129953128 TAGGTGGGGAAGTTGGGGGAGGG - Intergenic
1032412317 7:131705143-131705165 TAGGGGTGAAGGTGAGGGGAGGG + Intergenic
1032477866 7:132224663-132224685 CAGAGGGGAAAGTGGAGGGAGGG + Intronic
1032502456 7:132410121-132410143 TAGGGGTGAAAGTTGGGGGATGG + Intronic
1032911692 7:136439635-136439657 TGGGGGGTAGAGTGGGGGGAGGG - Intergenic
1033159282 7:138981771-138981793 TAGGCCGGCAAGCCGGGGGAGGG + Intergenic
1034757391 7:153635534-153635556 GAGGGGGGAGGGAGGGGGGAGGG - Intergenic
1035357392 7:158284680-158284702 TAGAGGGGACAGAGGTGGGATGG - Intronic
1035374782 7:158400891-158400913 TCTGGGGGAATGCGGGGGGTGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036371230 8:8164610-8164632 TAAAATGGAAAGCGGGGGGAGGG - Intergenic
1036495763 8:9268581-9268603 AAGGGGGGAAGGAGGGGGGGAGG + Intergenic
1036584076 8:10106882-10106904 TAGAGGGGTAGGCGGGTGGAGGG - Intronic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036756749 8:11476291-11476313 GATGGGGGAAAGCCGGGGGGCGG - Intergenic
1036879673 8:12501034-12501056 TAAAATGGAAAGCGGGGGGAGGG + Intergenic
1036938295 8:13026442-13026464 TAAGGGGGAAAGGGGTGGGGGGG + Exonic
1036972263 8:13368315-13368337 AAGGATGGAAAGCGGGGGAAGGG - Intronic
1037535306 8:19817775-19817797 GAGGGGAGAAAGCAGGGGGCCGG - Intronic
1038920342 8:32076568-32076590 GAGGGTGGAAAGTGGGTGGAGGG + Intronic
1039084768 8:33768900-33768922 TCGGGGGGAAAGGGTGGGAAGGG + Intergenic
1039096999 8:33897186-33897208 TGGGGTGGGGAGCGGGGGGAGGG - Intergenic
1039230845 8:35446155-35446177 TCGGGGGGAAAGTGTGGGAAGGG - Intronic
1039423894 8:37469452-37469474 TAGGGTGGAAGGCGGAAGGAGGG - Intergenic
1040548957 8:48423692-48423714 TAGGGAAGAAAGAGGGGTGAAGG + Intergenic
1042099768 8:65262425-65262447 AAGGGTGGAAAGCAGGGTGAGGG - Intergenic
1042292627 8:67185219-67185241 TAGGTGGGAAAGAAGGTGGACGG - Intronic
1042703990 8:71647396-71647418 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1043319701 8:78968698-78968720 AAGGGAGAAAAGCGGGGAGAGGG + Intergenic
1044765311 8:95566106-95566128 TTGGCGGGGAAGTGGGGGGACGG + Intergenic
1046159769 8:110345650-110345672 TAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1046242252 8:111511467-111511489 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
1046527504 8:115399070-115399092 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic
1046768735 8:118098000-118098022 GTGTGGGGAAAGCGGGGAGAAGG + Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047197181 8:122732381-122732403 TAGGAGGGAAAGCTGAGGCATGG - Intergenic
1048183861 8:132220957-132220979 TGGGGTGGAGAGCAGGGGGAGGG - Intronic
1048890224 8:138940494-138940516 TGGGGGGGAAGGTGGGGGGGTGG - Intergenic
1048890247 8:138940534-138940556 TGGGGGGGAAGGTGGGGGGGTGG - Intergenic
1049415885 8:142494868-142494890 TGGGGAGCAAAGCGGGGGGTGGG + Intronic
1049853024 8:144844374-144844396 TAGGGGGGAACGCGGTGAGGAGG + Intronic
1050070780 9:1811068-1811090 GAGGGTGGAGAGCGGGAGGAGGG + Intergenic
1050517003 9:6455279-6455301 TGGGGTGGAGAGAGGGGGGAGGG - Intronic
1051196596 9:14568401-14568423 GAGGGCGGAAAGAGGGAGGAAGG + Intergenic
1052213550 9:25936965-25936987 GAGGGGGAAATGTGGGGGGATGG - Intergenic
1052514154 9:29458577-29458599 TTGGGGGGAAAGGGTGGGAAGGG - Intergenic
1052617270 9:30857016-30857038 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
1052629499 9:31019194-31019216 AGGGAGGGAAAGCGAGGGGAGGG + Intergenic
1053405424 9:37871187-37871209 TATTGGGGAAGGTGGGGGGAGGG + Intronic
1054449786 9:65397598-65397620 TAGAGAAGACAGCGGGGGGAGGG + Intergenic
1056065859 9:82933895-82933917 TGGGGTGGGAAGAGGGGGGAGGG - Intergenic
1057425974 9:94950141-94950163 CATGGGGGAAAGCTGGGGGAGGG - Intronic
1057702864 9:97376327-97376349 TTGGAGGGGAAGCTGGGGGAGGG - Intronic
1057819774 9:98322031-98322053 TAGGCTGGAGAGCGGTGGGAGGG - Intronic
1057935932 9:99238954-99238976 TGGTGGGCAGAGCGGGGGGAGGG - Intergenic
1058705484 9:107634484-107634506 TGGGGGGGGGTGCGGGGGGATGG - Intergenic
1059084199 9:111282409-111282431 TATGGGGGAGAGGGGAGGGAGGG - Intergenic
1059135621 9:111803459-111803481 TAAGGGGGAAAGGGGTGGGTTGG + Intergenic
1059341554 9:113600299-113600321 TAGATGAGAAAGCGGAGGGAAGG - Intergenic
1059474739 9:114536250-114536272 AAGGAGGGAAGGAGGGGGGAAGG + Intergenic
1060851058 9:126876194-126876216 GAAGGGGGAAAGGGGGGGAAAGG - Intronic
1060999001 9:127891773-127891795 GAGGGGGGAGAGGGAGGGGAGGG + Intronic
1061209704 9:129183715-129183737 TAGGGTGGAGACTGGGGGGATGG + Intergenic
1061255657 9:129453353-129453375 GAGGGGTGGAAGAGGGGGGATGG + Intergenic
1061761880 9:132857139-132857161 TAGGGAAGAAAGGTGGGGGAAGG - Intronic
1061923617 9:133795382-133795404 CTGGGGGAAAAGCAGGGGGAGGG + Intronic
1061942553 9:133891409-133891431 GAGGGGGGATGGAGGGGGGACGG + Intronic
1062189360 9:135239778-135239800 GAGGGGGGAAAGCTGGGAGACGG - Intergenic
1062255864 9:135620201-135620223 TAGGGGGAAAAGGGGGAGAAGGG - Intergenic
1062283593 9:135763065-135763087 CAGGGAGGAAGGCGGGGGCAGGG + Intronic
1062439251 9:136562366-136562388 TTGGGGGGAAAGCTGGGGTGAGG - Intergenic
1203470715 Un_GL000220v1:114315-114337 GAGGGGGGAGAGCGCGGCGACGG - Intergenic
1203478536 Un_GL000220v1:158287-158309 GAGGGGGGAGAGCGCGGCGACGG - Intergenic
1185587055 X:1248272-1248294 TGAGGGGGAAAGGGAGGGGAGGG + Intergenic
1185608452 X:1380480-1380502 GAGGGGGGAAAGGAGGGGGAAGG + Intronic
1185660206 X:1721811-1721833 TGGGGTGGAAGGAGGGGGGAGGG - Intergenic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186852444 X:13593612-13593634 TGGTGGGGAAAGCAGGGAGAGGG + Intronic
1187111468 X:16305265-16305287 TTGGGGGGGAAGGTGGGGGATGG + Intergenic
1187281637 X:17861527-17861549 TTGGGGGGAGCGCCGGGGGAGGG + Intergenic
1187708998 X:22035296-22035318 TGGGGAGGAAAGAGAGGGGAAGG - Intronic
1188329415 X:28850526-28850548 TAGGGGGAAGAGAGGGAGGAAGG - Intronic
1188821011 X:34775072-34775094 TTGGGGGGAAAGTGGAGGGAGGG + Intergenic
1188826579 X:34842297-34842319 TTGGGGGGCAAGGGGAGGGAGGG + Intergenic
1189360554 X:40347346-40347368 TCGGGGGGAAAGGGTGGGAAGGG + Intergenic
1189840661 X:45073013-45073035 TGGGGTGGAAGGCAGGGGGAGGG - Intronic
1190010252 X:46778519-46778541 TGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1191026791 X:55922458-55922480 TCAGGGGGACAGCAGGGGGAGGG + Intergenic
1191735105 X:64380735-64380757 TAGGGTGGAAGGAGGGGGGAGGG - Intronic
1191740846 X:64434179-64434201 TAGGGTGGAAAGGGGTTGGAGGG - Intergenic
1192821726 X:74653407-74653429 AAGTGGGCAAAGCGGGGGGACGG - Intergenic
1193164480 X:78265282-78265304 AAGGGGGGAAAGGTGGGGAACGG - Intergenic
1193198761 X:78663285-78663307 TAGGGGAGAAGGCGAGGAGAAGG + Intergenic
1193947611 X:87757401-87757423 GAGGGTGGAGAGCGGGAGGAGGG - Intergenic
1194027779 X:88775323-88775345 AAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1194799160 X:98250512-98250534 TGGGGCTGAAAGCAGGGGGAGGG - Intergenic
1194900867 X:99510153-99510175 TTGGGGGGCATGCGGAGGGAGGG - Intergenic
1195368311 X:104148301-104148323 TAGGGTGGGAGGAGGGGGGAGGG + Intronic
1195537678 X:106027289-106027311 GAGAGGCCAAAGCGGGGGGAGGG - Intergenic
1195572593 X:106413006-106413028 TGGGGTGGGAGGCGGGGGGAGGG + Intergenic
1196032317 X:111103823-111103845 TGGGTGGGAAAGCAGAGGGAAGG - Intronic
1196423149 X:115543435-115543457 AAGGGGGGAAAAAGGGGGGGTGG - Intergenic
1197215182 X:123860318-123860340 AAGGAGGGAAAGCGGGGGAGGGG - Intronic
1197550378 X:127885686-127885708 TATGGTGGAAAGCTGGAGGAAGG + Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197939455 X:131774283-131774305 TGGGGGGGGGAGCAGGGGGATGG + Intergenic
1198051392 X:132956341-132956363 TAGGGGGGAAAGCGGGGGGAGGG + Intronic
1198242024 X:134796589-134796611 GAGGGGGGAAAGGGAGAGGAAGG + Intronic
1198476105 X:136999789-136999811 AAGGGGGGAAAGGCGGGGAAAGG - Intergenic
1198885365 X:141329666-141329688 GAGGGTGGAAAGTGGGAGGAGGG + Intergenic
1199000260 X:142628162-142628184 TAGGGTGGATAGCAGGAGGAGGG - Intergenic
1199330052 X:146548975-146548997 GAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1199851881 X:151729665-151729687 TAGGAGGGACAGTGGGGGGGGGG - Intergenic
1199912266 X:152299429-152299451 TAAGCGGGGAAGCAGGGGGAAGG + Intronic
1201952476 Y:19580647-19580669 TAGGGTGGGGAGAGGGGGGAGGG - Intergenic
1202013969 Y:20380564-20380586 TGGGGTGGGAAGAGGGGGGAGGG - Intergenic
1202035464 Y:20629145-20629167 TGGGGTGGGAAGAGGGGGGAGGG + Intergenic