ID: 1198055131

View in Genome Browser
Species Human (GRCh38)
Location X:132986378-132986400
Sequence GAATTTTCCCCCAGTGTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198055126_1198055131 24 Left 1198055126 X:132986331-132986353 CCTAAGTAGTAGATTTTTCACAC No data
Right 1198055131 X:132986378-132986400 GAATTTTCCCCCAGTGTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198055131 Original CRISPR GAATTTTCCCCCAGTGTGTG AGG Intergenic
No off target data available for this crispr