ID: 1198063067

View in Genome Browser
Species Human (GRCh38)
Location X:133066697-133066719
Sequence TAATTTTTGCATAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 25554
Summary {0: 1, 1: 193, 2: 9193, 3: 10717, 4: 5450}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198063067 Original CRISPR TAATTTTTGCATAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr