ID: 1198064388

View in Genome Browser
Species Human (GRCh38)
Location X:133082037-133082059
Sequence CCCAGACCTGTGATATCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198064383_1198064388 17 Left 1198064383 X:133081997-133082019 CCATATTTGCTGGCTGTATCTTG 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1198064388 X:133082037-133082059 CCCAGACCTGTGATATCCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 156
1198064386_1198064388 -8 Left 1198064386 X:133082022-133082044 CCACATAACGAAAGTCCCAGACC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1198064388 X:133082037-133082059 CCCAGACCTGTGATATCCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198064388 Original CRISPR CCCAGACCTGTGATATCCCT TGG Intronic
903190981 1:21655880-21655902 CCCAGACCTGAGATCTTCCCAGG - Intronic
904568788 1:31445205-31445227 CCCAAACTTGTGCAATCCCTAGG - Intergenic
904807591 1:33142708-33142730 ACCAGGACTGTGATCTCCCTGGG - Intergenic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907575223 1:55520249-55520271 CCCAGACCCCTGATTTCTCTAGG + Intergenic
907742464 1:57180335-57180357 CCCAATTCTGTTATATCCCTAGG + Intronic
911736778 1:101345128-101345150 CCCAGATGGATGATATCCCTGGG + Intergenic
913072226 1:115310184-115310206 CACATACATGTGATTTCCCTTGG - Intronic
915891146 1:159774962-159774984 CCCCGACCTGTGAGATCCTCAGG - Intergenic
916203648 1:162295063-162295085 CCCAGTCCTGTGGGTTCCCTGGG + Intronic
919114883 1:193268774-193268796 CCCAGGCCTCTGCTCTCCCTTGG - Intergenic
1067018111 10:42772575-42772597 CCCAGACCTGGGAGCTCCCCAGG + Intergenic
1067247457 10:44558533-44558555 CCCAGAAATGTGATATCTCCTGG + Intergenic
1067421807 10:46158698-46158720 CCCAGACCTGGGAGCTCCCCAGG - Intergenic
1067507113 10:46864787-46864809 CCCAGACCTGGGAGCTCCCCAGG - Intergenic
1069370956 10:67747114-67747136 GACAGAACTGTGATCTCCCTGGG + Intergenic
1069956326 10:72054140-72054162 CACAGAGCTCTGAAATCCCTTGG + Intergenic
1069992221 10:72322773-72322795 CCCAGCCCTGTGTTGTCCCCAGG - Intergenic
1070795305 10:79212960-79212982 CCCTGACCTGTGAGGTCCCCTGG + Intronic
1070859283 10:79637834-79637856 CCCAGACCTGGGAGCTCCCGAGG - Intergenic
1072429242 10:95356382-95356404 CCCACACCTGTGCTGTCCCGGGG - Intronic
1072746371 10:97941875-97941897 CCCAGACCTGTGATCACTCCTGG + Intronic
1074266001 10:111903941-111903963 CCCTGTCTTGTGATAACCCTGGG - Intergenic
1078099341 11:8320591-8320613 CCCAGCCCTGAGCTATCCCCTGG - Intergenic
1078223808 11:9374038-9374060 CCTAGTCCTGTGAGATCTCTAGG - Intergenic
1078519859 11:12054054-12054076 CACAGACCTGTGCCACCCCTGGG + Intergenic
1080243002 11:30148515-30148537 CCAAGACTTGTGATTTCCATTGG + Intergenic
1083362958 11:62124106-62124128 CCAAGTCCGGTGGTATCCCTAGG - Exonic
1083673634 11:64313849-64313871 CCCAGACCTGTGCTTGCCCGGGG + Intronic
1085251314 11:75145701-75145723 CCCAGAGCTGTCATATGGCTTGG - Intronic
1085299367 11:75449430-75449452 CCCCGACCTGGGCTTTCCCTGGG - Intronic
1086082152 11:82915125-82915147 CCCATTTCTGGGATATCCCTGGG + Intronic
1089112162 11:116065471-116065493 CCCAGACCTGGGGTGTCTCTAGG - Intergenic
1090745467 11:129701694-129701716 CCTAGACTTCTGATACCCCTGGG - Intergenic
1091933488 12:4416253-4416275 CCCAGACCTGAGACATGCCATGG - Intergenic
1096207289 12:49733758-49733780 TCCAGCCCTTTGATCTCCCTTGG + Intronic
1096672947 12:53211011-53211033 CCCAGCCCTGTCATGTGCCTTGG - Exonic
1098694653 12:73537583-73537605 CCTAAGCCTGTGATTTCCCTGGG + Intergenic
1101457906 12:104856107-104856129 CCCAGACCAGCAATATCACTTGG - Intronic
1104377527 12:128278054-128278076 CCCAGGACTGTGGGATCCCTGGG + Intronic
1104384370 12:128337638-128337660 CCCAGACCTGAGACCTCCCCGGG - Intronic
1106829857 13:33568477-33568499 CCTAAACATTTGATATCCCTGGG - Intergenic
1108281281 13:48864715-48864737 CCCTGAGGTCTGATATCCCTGGG + Intergenic
1112463667 13:99624669-99624691 CCCAGCGCTGAGATATCCCCGGG + Intronic
1118787451 14:69057886-69057908 CCCAGACCTGTCATTTCCTGTGG + Intronic
1119439656 14:74619691-74619713 CCCAGACCTGGCAAATCCCCAGG + Intergenic
1120510526 14:85408257-85408279 CCTAAACCTGTTATATCCCATGG - Intergenic
1122276355 14:100592729-100592751 CCCAGACCTCTGAGAGCCTTAGG + Intergenic
1122976459 14:105172843-105172865 CCCTGACCTGAGATGGCCCTCGG - Intergenic
1125746521 15:42000917-42000939 CCCAGACCTGAGATACTCCAAGG + Intronic
1127446587 15:59069223-59069245 TCCAGACCTGTCCTATCTCTTGG + Intronic
1127585453 15:60373663-60373685 CTCAGACCTGTGAGATCCTGGGG + Intronic
1128761174 15:70216977-70216999 CCCAGCCCTGGCATAGCCCTTGG - Intergenic
1128856725 15:71024096-71024118 GACAGACCTCTGATCTCCCTGGG + Intronic
1130738085 15:86571192-86571214 CTCAGACCTGGGAGCTCCCTGGG - Intronic
1131512658 15:93057798-93057820 CCCAGGCCTGGGCAATCCCTGGG - Intronic
1132325233 15:100963505-100963527 CCCAGGCCTGTGCTGGCCCTTGG + Intronic
1132518571 16:377164-377186 CCCACACCTGTTCTTTCCCTAGG - Exonic
1132542297 16:516191-516213 CCCAGCCCTGTGCTGCCCCTGGG + Intronic
1133232585 16:4373535-4373557 CCCAGACCTGTGCTTACCCGAGG + Intronic
1133531778 16:6661714-6661736 CCCAGCCCTGTGATTTCTCAGGG - Intronic
1135561231 16:23478604-23478626 CCCAGACTGGTGACATCTCTTGG + Intronic
1136019722 16:27432398-27432420 CCCAGACATGGGATGGCCCTGGG + Intronic
1136085366 16:27881023-27881045 CCCTGACCTGGGAGATCCCTCGG - Intronic
1137574606 16:49590614-49590636 CCCAGCCCTGTGCTTCCCCTTGG + Intronic
1138475586 16:57269055-57269077 CCCAGCCCTCAGATCTCCCTTGG + Intronic
1139279488 16:65757895-65757917 CCTATTCCTGTGATCTCCCTAGG + Intergenic
1139302106 16:65954248-65954270 TCCAGACCTGCCATATCCCTGGG + Intergenic
1139315690 16:66066273-66066295 CCCAGAGCTGTGTTGTACCTGGG + Intergenic
1139618167 16:68113732-68113754 GACAGAACTCTGATATCCCTGGG - Intronic
1142774369 17:2124640-2124662 CTGAGACCTGTGATCTCCCCGGG + Intronic
1144491719 17:15718485-15718507 CTCAGACCTTCAATATCCCTGGG - Exonic
1144908762 17:18660720-18660742 CTCAGACCTTCAATATCCCTGGG + Exonic
1147157681 17:38552414-38552436 CCCTGACCTCTGATTTCCCATGG - Intronic
1149518668 17:57301486-57301508 CCAATACCTTTGATACCCCTGGG + Intronic
1153177759 18:2398199-2398221 CTCTTACCTGTGATATGCCTAGG - Intergenic
1159334418 18:67044360-67044382 CCCAGGCCTGTGACACCCTTTGG + Intergenic
1163451605 19:17380684-17380706 CCCAGGCCTGTGAGAGCACTGGG + Intergenic
1163886104 19:19966248-19966270 GACAGAACTGTGATCTCCCTGGG - Intergenic
1163888363 19:19989230-19989252 GACAGAACTGTGATCTCCCTGGG + Intergenic
1166276068 19:41755167-41755189 CCCAGACGTGTGAGAACACTAGG + Intronic
1167215571 19:48162244-48162266 CCCAGCCCTGTGACATACTTTGG + Exonic
1167477939 19:49711778-49711800 CCATGACCTGTGACCTCCCTGGG + Intronic
1168584426 19:57581631-57581653 CCCACACCTGCGGAATCCCTTGG + Intronic
926710472 2:15875506-15875528 CCCAGTCCTGAGACAACCCTGGG - Intergenic
926735985 2:16073672-16073694 TCCAGCCCTGTGATCTGCCTTGG - Intergenic
926919542 2:17926789-17926811 CCAAGACCTCTGATATGCCCTGG + Intronic
928274137 2:29883448-29883470 CTCTGCCCTGTGATATTCCTTGG + Intronic
935678401 2:105616104-105616126 CACAGCCCTGTGATATGCCTTGG + Intergenic
939737517 2:145866841-145866863 CTTAAACCTGTGATATCGCTAGG - Intergenic
942543512 2:177038838-177038860 CCCACTCCTGTGGTATCCGTGGG - Intergenic
943657827 2:190528190-190528212 GCCAGCCCTTTGATATCCCTGGG - Intronic
944886407 2:204066808-204066830 CCCAGCCCTGTGATATCTTGAGG + Intergenic
948958146 2:241310784-241310806 CCCAGAACAGTGATGTCCCTTGG - Intronic
1171279148 20:23881759-23881781 CCCAGACCTGCTATAATCCTGGG + Intergenic
1171954417 20:31449491-31449513 CCCAGACCTGTGCAATCACTGGG + Intronic
1171962576 20:31505307-31505329 CCCAGATCTGTGAGCTTCCTTGG - Intergenic
1173006132 20:39141159-39141181 CACTGACCTGTGGTATCCCCAGG + Intergenic
1173335848 20:42111987-42112009 CCCAGGCCTGTGGTCTCCCATGG - Intronic
1173419410 20:42887621-42887643 CCCAGACCTGAGATTTCCTCTGG + Intronic
1175876402 20:62232276-62232298 CCCAGGGCTGGGAGATCCCTGGG - Intronic
1176228322 20:64016727-64016749 CCCAGCCCTGTCACATTCCTCGG - Exonic
1177894194 21:26841955-26841977 CCCAGACATGTGATACTCTTGGG - Exonic
1179034283 21:37746313-37746335 CCCAGATCTGGATTATCCCTGGG - Intronic
1179505947 21:41840472-41840494 CCTAGACCTGTGAAAGCTCTGGG + Intronic
1180971623 22:19819068-19819090 CCCAGCCCTGGGCTAACCCTCGG + Intronic
1183084756 22:35479996-35480018 CCCTGACCTGTGATGTGCTTAGG - Intergenic
1184469384 22:44687385-44687407 CCCAGGCCTGTGACAGCCGTAGG - Intronic
1185089706 22:48758981-48759003 CCCACACCTGAGATTCCCCTGGG - Intronic
949216353 3:1573581-1573603 GCCAGCCCTGTAATATCCGTAGG - Intergenic
950220653 3:11192894-11192916 CCCATACCTCTAATAGCCCTGGG - Intronic
951189179 3:19749208-19749230 CACAGGCCTGTGATATTCCTTGG - Intergenic
955020043 3:55111066-55111088 ACCAGCTCTGTGATCTCCCTAGG + Intergenic
957621203 3:82595126-82595148 TGAAGACCTGTGATATGCCTTGG + Intergenic
959083631 3:101828510-101828532 CCTAGAACTATGATATCCCGAGG + Intronic
959883510 3:111473545-111473567 CACAGAACTCTGATCTCCCTGGG - Intronic
961788371 3:129360835-129360857 TCAAGGCCTGTGATATTCCTGGG + Intergenic
964763568 3:160157246-160157268 CCCACACCTGTGATTTCACCTGG + Intergenic
965788697 3:172364327-172364349 CCCAGACCTGTGGCTTCCATTGG + Intronic
965849921 3:173010767-173010789 CACAGGCCTGTGATTTCCGTTGG + Intronic
967938425 3:194747703-194747725 CCCACACCTGTGACATCACGTGG - Intergenic
976527850 4:86114825-86114847 GACAGAACTCTGATATCCCTGGG - Intronic
976968573 4:91077107-91077129 ACCAGACCTGTGAGACCCCTGGG - Intronic
977462008 4:97337342-97337364 GACAGAACTGTGATCTCCCTAGG + Intronic
977895931 4:102365240-102365262 CCCAAACCTGTATTATCCATGGG - Intronic
983316044 4:166134159-166134181 AACAGAACTGTTATATCCCTGGG - Intergenic
983745128 4:171189083-171189105 TCCAGTCCTGAGCTATCCCTTGG - Intergenic
983850792 4:172578035-172578057 CCCTCACATGTAATATCCCTTGG + Intronic
988110506 5:26813207-26813229 GACAGAACTCTGATATCCCTGGG + Intergenic
993479071 5:88400471-88400493 CCCAGATCTGAGATGTCTCTAGG - Intergenic
998108240 5:139481942-139481964 ACCACACCTGTGGTCTCCCTGGG - Intronic
1000401962 5:160838750-160838772 CCAAGACCTGTGATGTCATTTGG + Intronic
1001266132 5:170275917-170275939 CCCTGACCCTTGATATCCCCTGG + Intronic
1001825307 5:174740181-174740203 CCCAGAACTGTTATATGACTTGG - Intergenic
1005881773 6:30067572-30067594 CCCACACCTCCCATATCCCTAGG - Intronic
1007239265 6:40413488-40413510 CCCAGGCCTGTGCTGTCTCTAGG + Intronic
1009859711 6:69311539-69311561 CTCAAACCTCTGATCTCCCTAGG + Intronic
1013131284 6:107235358-107235380 CCCAGCCCTGTGTGATCTCTAGG - Intronic
1013271110 6:108546163-108546185 CCCATATCTATGATATCACTGGG - Intergenic
1014323454 6:119961708-119961730 CCAAGTCCTGTGATTTCCATTGG - Intergenic
1015341201 6:132103045-132103067 CCCAAACCTGTCATTTCTCTTGG - Intergenic
1016423764 6:143912894-143912916 CCCTGGCCTGTGTTGTCCCTGGG - Intronic
1024144382 7:46497875-46497897 CTTAGAACTGTGATATACCTGGG + Intergenic
1025260731 7:57415908-57415930 ACCAGACCTGGTATTTCCCTGGG + Intergenic
1026970228 7:74463197-74463219 CCCAGAGATGTGACATCACTCGG - Intronic
1031490644 7:122383647-122383669 GTCTGACCTGTGATTTCCCTGGG - Intronic
1032536638 7:132669883-132669905 CCCAGACCTGAGAAATCATTAGG + Intronic
1036480903 8:9138876-9138898 CCCAAACCTGTGATTTTTCTTGG - Exonic
1040978951 8:53225469-53225491 CCCAGACCTGTGAATTGCTTAGG - Intergenic
1043758385 8:84032270-84032292 CCCAGACCTAGGAGCTCCCTGGG + Intergenic
1047513862 8:125536709-125536731 CTCTGATCTGTGAAATCCCTAGG + Intergenic
1051848863 9:21485772-21485794 CCCAGCCCTGTGTTAGCACTGGG + Intergenic
1054455006 9:65425974-65425996 CTCAGAGCTCAGATATCCCTGGG - Intergenic
1059650711 9:116313395-116313417 CCCAAACCTGTGACTTCCCCAGG - Intronic
1061725203 9:132578798-132578820 CCCAGACCTCGGCTTTCCCTTGG - Intergenic
1185993696 X:4920115-4920137 CCCACACCTCTGAGACCCCTAGG + Intergenic
1188243931 X:27819546-27819568 CCCAGCCCTGTGTAAGCCCTGGG + Intronic
1189737562 X:44087259-44087281 CAAAGACCTGAGATAACCCTGGG + Intergenic
1192428632 X:71097937-71097959 ATCAGATCTGTGCTATCCCTAGG + Intronic
1193918706 X:87399937-87399959 CGCAGACCTCTGACATGCCTTGG - Intergenic
1194610263 X:96034979-96035001 CCCAGACCTTTTGTACCCCTGGG - Intergenic
1195941883 X:110173957-110173979 CCACGAGCTGTGAAATCCCTCGG - Exonic
1196893269 X:120310284-120310306 CCAAGCCCTGTGATTTCACTGGG - Intronic
1198064388 X:133082037-133082059 CCCAGACCTGTGATATCCCTTGG + Intronic
1200258851 X:154600953-154600975 CCCAGACCTATGCCATCTCTAGG + Intergenic