ID: 1198071278

View in Genome Browser
Species Human (GRCh38)
Location X:133150923-133150945
Sequence TAGAATCAACAGAAGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198071273_1198071278 15 Left 1198071273 X:133150885-133150907 CCATGTTATTTGCCTAGTTTCAC No data
Right 1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG No data
1198071277_1198071278 -7 Left 1198071277 X:133150907-133150929 CCTTGAAGGGCTTGCTTAGAATC No data
Right 1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG No data
1198071276_1198071278 3 Left 1198071276 X:133150897-133150919 CCTAGTTTCACCTTGAAGGGCTT No data
Right 1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198071278 Original CRISPR TAGAATCAACAGAAGCAGAG TGG Intergenic
No off target data available for this crispr