ID: 1198078553

View in Genome Browser
Species Human (GRCh38)
Location X:133217244-133217266
Sequence ATGGCTCAGGGAACTTTTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 2, 2: 3, 3: 16, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198078553_1198078560 8 Left 1198078553 X:133217244-133217266 CCTCCAAAAGTTCCCTGAGCCAT 0: 1
1: 2
2: 3
3: 16
4: 202
Right 1198078560 X:133217275-133217297 CGTACGGCTCCAGAGCCTTTGGG 0: 2
1: 0
2: 2
3: 3
4: 29
1198078553_1198078562 21 Left 1198078553 X:133217244-133217266 CCTCCAAAAGTTCCCTGAGCCAT 0: 1
1: 2
2: 3
3: 16
4: 202
Right 1198078562 X:133217288-133217310 AGCCTTTGGGACCAAATTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 99
1198078553_1198078557 -8 Left 1198078553 X:133217244-133217266 CCTCCAAAAGTTCCCTGAGCCAT 0: 1
1: 2
2: 3
3: 16
4: 202
Right 1198078557 X:133217259-133217281 TGAGCCATTTCTGTCACGTACGG 0: 2
1: 1
2: 3
3: 9
4: 59
1198078553_1198078559 7 Left 1198078553 X:133217244-133217266 CCTCCAAAAGTTCCCTGAGCCAT 0: 1
1: 2
2: 3
3: 16
4: 202
Right 1198078559 X:133217274-133217296 ACGTACGGCTCCAGAGCCTTTGG 0: 2
1: 1
2: 1
3: 4
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198078553 Original CRISPR ATGGCTCAGGGAACTTTTGG AGG (reversed) Exonic
900846791 1:5110375-5110397 ATGGAGCAGGGACCTTTTGTTGG + Intergenic
901403992 1:9033867-9033889 ATGGTTCAGGGAACGATGGGAGG - Intergenic
902007141 1:13241356-13241378 ATGGTTCAGAGAACTTTGGCTGG + Intergenic
904317348 1:29674051-29674073 TTGGCTCAGAGAAGTCTTGGGGG + Intergenic
905217299 1:36417851-36417873 ATGGCTCAGGAGGCTTTTGGTGG + Intronic
905409008 1:37755442-37755464 ATGGTCCAGGGAACTTTTACTGG - Intronic
906859481 1:49343432-49343454 ATGGCTAATGGAAGTTATGGAGG + Intronic
907154500 1:52320749-52320771 GGGGCTCAAGGAAATTTTGGGGG + Intronic
907841307 1:58160240-58160262 ATGGCTCTGGGAACTTCTCCTGG + Intronic
907857223 1:58315459-58315481 ATTGCTCAGGGAATGTTTGTTGG - Intronic
912857860 1:113187750-113187772 ATGCATGAGGGAACTTTCGGTGG - Intergenic
913249254 1:116898680-116898702 ACGGCACAGAGAACTTTTGGAGG + Intergenic
915452606 1:156016906-156016928 ATGCCTCAGGGAACTTATAATGG - Intronic
916163985 1:161948080-161948102 ATGGCTTAAGGTACTTTGGGAGG - Intronic
917782778 1:178416935-178416957 ATGCCTCAGTGTAGTTTTGGGGG + Intronic
920805941 1:209233202-209233224 ATGGCTCAGGGAACTGGTGGAGG + Intergenic
921292289 1:213670034-213670056 ATTGCTCAGGAAACTTTTTATGG + Intergenic
921557570 1:216616887-216616909 ATATCTCAGGGAATCTTTGGGGG - Intronic
921925696 1:220708457-220708479 GAAGCTCAGGGAATTTTTGGAGG - Intergenic
924056368 1:240127947-240127969 ATGGCTGATGGGACTTCTGGTGG + Intronic
1063521509 10:6745656-6745678 ATGGCTCTGGGAAAGTTTTGCGG + Intergenic
1063829985 10:9941565-9941587 TTGGCTCATGCAATTTTTGGAGG + Intergenic
1064579992 10:16784480-16784502 AGACCTCAGGGAACTTATGGTGG + Intronic
1066028018 10:31384600-31384622 ATTGCTCAGGGAAGTTTTGTAGG + Intronic
1067801771 10:49363901-49363923 TTGGCTCAGGAACCTTTTAGTGG - Intergenic
1067932373 10:50575625-50575647 AGGACACAGGAAACTTTTGGAGG + Intronic
1070403812 10:76076881-76076903 ATGGATTCAGGAACTTTTGGAGG - Intronic
1070639748 10:78159250-78159272 AGGGCACAGGAAACTTTTGGGGG - Intergenic
1071962210 10:90818067-90818089 AGAGCACTGGGAACTTTTGGGGG + Intronic
1074466760 10:113690655-113690677 TTGGCTCTGGGTGCTTTTGGCGG + Intronic
1074833230 10:117264247-117264269 ATGGCCCAGGGCACTGTTGCAGG + Intronic
1075069950 10:119314039-119314061 GTGGCACAGGGAACTTTCTGGGG + Intronic
1075298190 10:121296622-121296644 ATGGCCCAGGGAATTTTGTGGGG - Intergenic
1075499901 10:122963856-122963878 ATAGCCCAGGGAACTTCTGAAGG + Intronic
1080288718 11:30645961-30645983 ATGGCTCATGGTGCATTTGGGGG - Intergenic
1083807356 11:65082802-65082824 GTGGCTCAGGGAATGTTTCGTGG - Intronic
1086406384 11:86502758-86502780 ATGGCTCAGGGGAGGTTTGGGGG + Intronic
1086984839 11:93236476-93236498 ATGGCTGAAGGACCGTTTGGGGG - Intergenic
1088019748 11:105105124-105105146 ATGGCTAAGAGTATTTTTGGAGG + Intergenic
1090807452 11:130211250-130211272 AAGGCTTAGGGAGCTTTTGGGGG + Intergenic
1092653263 12:10656985-10657007 ATGGCTAATGGAAGTTATGGGGG + Intronic
1093707625 12:22292195-22292217 ATTCCTCATGGAACTTTTTGAGG - Intronic
1096661027 12:53124064-53124086 CTGGCTCAGGCAACTTTCTGGGG + Exonic
1097769202 12:63561395-63561417 AGGGCACAGGGAACTTGTGGGGG - Intronic
1099207006 12:79740075-79740097 GTGGCTCAGGCCACTTTGGGAGG - Intergenic
1101580323 12:106037009-106037031 AGGCCTCAGGAAACTTATGGTGG + Intergenic
1102746525 12:115253613-115253635 AAGACTCAGGCAACTGTTGGGGG - Intergenic
1102934918 12:116888419-116888441 TTGGGCCAGGTAACTTTTGGTGG - Intergenic
1105763413 13:23533999-23534021 ATAGCACAGGGAATTTTTGGAGG - Intergenic
1107357127 13:39579268-39579290 ATGGCTCAGAAGACTTGTGGTGG - Intronic
1107923336 13:45232751-45232773 ATGACTAAAGGAACTTATGGTGG - Intronic
1108576683 13:51797109-51797131 ATGACTGAGGGTCCTTTTGGGGG + Intronic
1113882911 13:113637820-113637842 ATGGCTCAGGGAACTGTTGGAGG + Exonic
1114053426 14:18943333-18943355 ATGGTTGAGGAAACTGTTGGGGG - Intergenic
1114109133 14:19458592-19458614 ATGGTTGAGGAAACTGTTGGGGG + Intergenic
1116170242 14:41391641-41391663 ATGGTTCAGGGAAGATTGGGTGG - Intergenic
1118005432 14:61561160-61561182 ATGGCTATGGGAACTTTAGATGG - Intronic
1120969482 14:90195442-90195464 ATGGCTCACAGCACTTTGGGAGG + Intergenic
1121096807 14:91223129-91223151 ATGGTTCAGGGAACATTTTCTGG - Intronic
1121255502 14:92527636-92527658 AGGGCCCAGGGGGCTTTTGGAGG - Intronic
1121708470 14:96018953-96018975 ATATCTCAGAGAAGTTTTGGAGG - Intergenic
1129948060 15:79559457-79559479 ATGGCTCAGGGAACTGTGGGAGG - Intergenic
1130677178 15:85963357-85963379 ATGGCTTAGGGAAGTTCTTGTGG - Intergenic
1131369835 15:91870945-91870967 ATGGCTCAAAGATCTTTTGGGGG + Intronic
1131706674 15:95003737-95003759 ATGGCACAGAGAACATTCGGTGG - Intergenic
1131778346 15:95826802-95826824 ATGGCTCAGGGAAGGTGTGATGG + Intergenic
1132085219 15:98902884-98902906 ATGGCTCAGGAGACTTTTTGAGG - Intronic
1132130266 15:99270841-99270863 ATGGCTCAGCCACTTTTTGGTGG - Intronic
1132728351 16:1348514-1348536 ATGCTTCAGGGAACTTGGGGTGG - Exonic
1135956240 16:26958846-26958868 ATGGCTCTGGGAAGGCTTGGGGG - Intergenic
1136713230 16:32257309-32257331 ATGACAAAGGGAACTTGTGGGGG + Intergenic
1136754682 16:32672118-32672140 ATGACAAAGGGAACTTGTGGGGG - Intergenic
1136813430 16:33198246-33198268 ATGACAAAGGGAACTTGTGGGGG + Intronic
1136819906 16:33308326-33308348 ATGACAAAGGGAACTTGTGGGGG + Intergenic
1136826470 16:33364866-33364888 ATGACAAAGGGAACTTGTGGGGG + Intergenic
1136831536 16:33463637-33463659 ATGACAAAGGGAACTTGTGGGGG + Intergenic
1137357359 16:47779657-47779679 ATGACTCAGGGAACATTTCCTGG - Intergenic
1138397724 16:56718706-56718728 AGAGCACAGGGAACTTTTTGAGG - Intronic
1138704337 16:58898863-58898885 ATGGATCATGCAAATTTTGGAGG - Intergenic
1139750663 16:69107231-69107253 CTGGCTGAGGGACATTTTGGGGG + Intronic
1140379851 16:74476710-74476732 AGCACTCAGGGAATTTTTGGGGG + Intronic
1140710111 16:77669874-77669896 GTGGCTCGTGGATCTTTTGGGGG - Intergenic
1202992007 16_KI270728v1_random:21221-21243 ATGACAAAGGGAACTTGTGGGGG + Intergenic
1203056828 16_KI270728v1_random:932453-932475 ATGACAAAGGGAACTTGTGGGGG - Intergenic
1145014597 17:19387906-19387928 ATGGGCCAGGGAACTGTGGGAGG - Intergenic
1145241877 17:21244953-21244975 GGGGCTCAGGAAACATTTGGTGG - Intronic
1150743570 17:67798771-67798793 TGGGCCCATGGAACTTTTGGTGG - Intergenic
1150932445 17:69599718-69599740 AGGCCTCAGGAAACTTATGGTGG - Intergenic
1151430981 17:74062928-74062950 ATGGCTCTGGAACCTTTAGGAGG + Intergenic
1153489581 18:5633007-5633029 ATGGCTCACAGCACTTTGGGAGG + Intergenic
1159146563 18:64461982-64462004 ATAGCTCAGGGAATTTTTGAGGG + Intergenic
1160175938 18:76594049-76594071 CTGGCACTGGGAAGTTTTGGAGG - Intergenic
1160202250 18:76805742-76805764 GTGGCTCAGGGAAGTCTTAGGGG + Intronic
1160794476 19:938540-938562 ATGGCCCAGGGAGCTGCTGGTGG + Intronic
1162870193 19:13580668-13580690 ATGGCACAGTGGAGTTTTGGAGG - Intronic
1163130810 19:15271734-15271756 ATGGCTCAGGAAAGGTATGGAGG - Intronic
1164051498 19:21588088-21588110 ATGGCTCAAGGAAATTCTTGGGG + Intergenic
1166315106 19:41985218-41985240 GTGGCTCAGGGAGGTTCTGGAGG + Intronic
926356608 2:12046556-12046578 ATGGCTCAGTGAACATCTGTTGG + Intergenic
929560109 2:42951177-42951199 AAGGCACAGGGAAGGTTTGGAGG + Intergenic
929596186 2:43177846-43177868 ATGGCCCAGGAAGCTTTTTGAGG + Intergenic
929998202 2:46842787-46842809 GTGTCTCAGGGAACTTTTGAAGG + Intronic
930812705 2:55559672-55559694 AGGCCTCAGGAAACTTGTGGCGG - Intronic
934605555 2:95692584-95692606 ATGGATAAGGGATGTTTTGGGGG - Intergenic
936524784 2:113235252-113235274 ATTCCTCCGGCAACTTTTGGAGG - Intronic
939539284 2:143473861-143473883 ATGTCTCAAGAAGCTTTTGGAGG + Intronic
940216330 2:151307446-151307468 CTGGTTCAGGGACATTTTGGAGG - Intergenic
945835261 2:214832280-214832302 ATTGCTCAAGGAATTTTAGGTGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1169500255 20:6153013-6153035 AGGCCTCAGGAAACTTATGGCGG + Intergenic
1169520181 20:6363035-6363057 ATATATGAGGGAACTTTTGGAGG - Intergenic
1171097047 20:22342347-22342369 ATGGCTCAGGGCACATGCGGAGG + Intergenic
1171119395 20:22555732-22555754 ATGGCTTAGGGAAATTTCTGGGG - Intergenic
1171966888 20:31537268-31537290 AAGGCTCAGGAGACTTGTGGTGG + Intronic
1172765453 20:37348348-37348370 ATGGCTCAGTGACCTGTTGAGGG + Intronic
1173205051 20:40986220-40986242 ATGGCCCAGGGACCATTTTGGGG + Intergenic
1173205236 20:40987643-40987665 ATGGCCCAGGGACCATTTTGGGG - Intergenic
1174369707 20:50078245-50078267 GTGGCTCACGGCACTTTGGGAGG + Intergenic
1177142230 21:17369568-17369590 AGGACTCAGGAAACTTATGGTGG - Intergenic
1177437849 21:21080107-21080129 AGGGCAAAGGAAACTTTTGGAGG + Intronic
1177539376 21:22471742-22471764 AAGCCTCAGGAAACTTATGGTGG - Intergenic
1177709439 21:24752806-24752828 ATGGCTCAGGGCAGGATTGGTGG - Intergenic
1179929845 21:44559946-44559968 ATGGCTAAGGGCTCTGTTGGAGG + Intronic
1180556991 22:16586098-16586120 TTGGCACAGGGAACTTCTTGGGG + Intergenic
1181855151 22:25776014-25776036 GGGGCCCAGAGAACTTTTGGGGG - Intronic
1183738063 22:39654795-39654817 AGGACTCAGGGTCCTTTTGGGGG - Intronic
1183862617 22:40680742-40680764 ATGGCTCAGGGCACTCTGGTAGG + Intronic
1184715345 22:46278853-46278875 GTGGCTCTGGGGACTTTGGGGGG - Intronic
949705904 3:6816560-6816582 ATGGTTGAGGAAACTTCTGGAGG + Intronic
950206059 3:11082061-11082083 GAGGCTGAGGGAACCTTTGGAGG + Intergenic
950378456 3:12591160-12591182 ATGGCCCAGTGAACTAATGGTGG - Intronic
952690205 3:36196568-36196590 CTGGCTCAGGGACCTTCAGGTGG + Intergenic
953609486 3:44435679-44435701 ATGGATCAGGGAACTAGTGTGGG + Intergenic
953631471 3:44621614-44621636 AGGCCTCAGGGAACTCATGGGGG - Intronic
954992552 3:54853897-54853919 ATTGTTCACGGAACTTTCGGTGG + Intronic
955359304 3:58259224-58259246 ACAGCCCAGGGAACTGTTGGGGG - Intronic
958025631 3:88045670-88045692 CTGCCTCAGGAAGCTTTTGGAGG + Intergenic
959085770 3:101849535-101849557 CTGGCTCAGGGAGCTGTCGGCGG - Exonic
959114798 3:102163899-102163921 AAGGCTCAGGGAAGTTATGAGGG + Intronic
959505549 3:107152602-107152624 CTGGCTGAGGGAAGCTTTGGGGG + Intergenic
959812862 3:110639369-110639391 TTGTGTCAGGGAACTTGTGGAGG + Intergenic
959995808 3:112679181-112679203 AGGGCCCAAGGAAATTTTGGGGG - Intergenic
961438146 3:126933330-126933352 ATGGCTCAGGAAGCTTTTGGTGG + Intronic
962129533 3:132658689-132658711 ATGGATCAGGGAACATTTTAGGG - Intronic
964054058 3:152430717-152430739 GCGGCTCAGGGAAGTGTTGGTGG + Intronic
967493877 3:190121645-190121667 AGGGCCCAGAGAACCTTTGGAGG + Intronic
973685024 4:53360785-53360807 ATACCTCAAGTAACTTTTGGGGG + Intronic
976271140 4:83231420-83231442 TTGGTTCAGGGCACTTTGGGAGG + Intergenic
976757226 4:88511529-88511551 ATGGCACAAGGAAGCTTTGGGGG + Intergenic
977733674 4:100384352-100384374 ATTTCTCAGGGAATATTTGGAGG + Intergenic
981594964 4:146409492-146409514 AGGGCACAGGGAAACTTTGGGGG + Intronic
981751708 4:148098627-148098649 AATGCTCAGGGCACTTTTGCAGG - Intronic
984180852 4:176480653-176480675 CTGGCTCAGTAGACTTTTGGTGG - Intergenic
985281099 4:188286028-188286050 ATGGCTCAAGCCACTTTGGGAGG + Intergenic
989103648 5:37841123-37841145 AAGGCTCAGGCAGCTTCTGGTGG - Intergenic
989710798 5:44394681-44394703 ATGGATTAGGGAACTTTTATTGG - Intergenic
990875943 5:60485907-60485929 AAGGCTCAAGGAAATTCTGGTGG - Intronic
992089920 5:73307569-73307591 AAGGCTCAAGGAACTTTTATTGG - Intergenic
994439388 5:99783479-99783501 ATCAGTCAGGGAAGTTTTGGAGG + Intergenic
995921223 5:117315645-117315667 ATGCCTCCTGCAACTTTTGGAGG + Intergenic
996403221 5:123085286-123085308 AGGGCACAGGCAACTTTTGGAGG - Intergenic
999518998 5:152330993-152331015 AGGCCTCAGGGAACTTGGGGTGG - Intergenic
1000570797 5:162911616-162911638 ATGCCTCAGGCAATTTTTGCAGG - Intergenic
1001330387 5:170758275-170758297 ATTGCTTAGGAAACTTATGGAGG - Intergenic
1003025345 6:2550166-2550188 ATGCCCCAGGGAACTCTTTGAGG - Intergenic
1004038274 6:11946761-11946783 ATTACTCAGGGAAATTTTGAGGG - Intergenic
1004427858 6:15518197-15518219 ATGGCTCTGGCACCTTGTGGGGG + Intronic
1006863774 6:37191931-37191953 AAGGGCCCGGGAACTTTTGGGGG - Intergenic
1012515741 6:100057142-100057164 ATTGCTGAGGCATCTTTTGGAGG + Intergenic
1014817467 6:125951668-125951690 ATGGGCTAGGGAACTATTGGAGG + Intergenic
1016405025 6:143720722-143720744 ATGACTCAGGGGACTTGAGGTGG - Intronic
1017871312 6:158488963-158488985 ATGGCTCTGGGTTCTTCTGGGGG - Intronic
1018818668 6:167355970-167355992 AGGGTTCAGGGAGCTCTTGGGGG + Intronic
1023832970 7:44050842-44050864 AGGGGTCAGGCAACTTCTGGAGG - Intronic
1025834311 7:65080914-65080936 ATGGCTGGGGGAAGTGTTGGGGG + Intergenic
1025904081 7:65770434-65770456 ATGGCTGGGGGAAGTGTTGGGGG + Intergenic
1026988085 7:74567491-74567513 ATGGTTCAGAGCAATTTTGGGGG + Intronic
1029708766 7:102288349-102288371 GTGGATCAGGGCATTTTTGGGGG + Intronic
1029737239 7:102471776-102471798 ATGGCCCAGGGGGCTGTTGGGGG - Intronic
1029737260 7:102471837-102471859 ATGGCCCAGGGGGCTGTTGGGGG - Intronic
1029824584 7:103176147-103176169 AGGGCACAGGGAACTTGTGGGGG - Intergenic
1029935934 7:104424280-104424302 TTGGCTCAAGGTACTTTTGTTGG + Intronic
1031240313 7:119229789-119229811 ATGCCACAGGGAATTTTTGAAGG + Intergenic
1031742222 7:125447981-125448003 ATGCCTCATGGAACTCATGGGGG - Intergenic
1032062333 7:128735575-128735597 AGGCCTCAGGGAAATTATGGCGG + Intergenic
1033050576 7:138000864-138000886 ATGCCTCAGAGATCTCTTGGGGG - Intronic
1034276449 7:149825958-149825980 AGGGCTAAGGGAGCTTTGGGTGG + Intergenic
1037350758 8:17952519-17952541 ATGGATCAGGAATATTTTGGGGG + Intronic
1039813204 8:41068428-41068450 ATGGATCATGTATCTTTTGGGGG - Intergenic
1039944386 8:42117249-42117271 ATGGCTATGGGGACTGTTGGCGG - Intergenic
1040558784 8:48505185-48505207 CTGGCCCAGGGGACTTTAGGAGG + Intergenic
1040809541 8:51436330-51436352 ATTATTCAGGGAAGTTTTGGAGG + Intronic
1041680287 8:60582203-60582225 ATGGCTCATGCCACTTTGGGAGG - Intronic
1045672488 8:104571592-104571614 AGGCCTCAGGAAACTTATGGTGG - Intronic
1047300853 8:123612462-123612484 ATTCCTCAGGGAACTATGGGTGG + Intergenic
1048080742 8:131123526-131123548 ATGTCTCATGGAACTACTGGGGG + Intergenic
1048236613 8:132697193-132697215 ATGGCAGAGGGATCTTTTTGGGG + Intronic
1048529822 8:135237217-135237239 GGGGCTCAGGTAACTTTAGGAGG + Intergenic
1048592303 8:135832138-135832160 ACGGCTCAAGGAAATCTTGGAGG + Intergenic
1049017046 8:139927958-139927980 AGGGCACAAAGAACTTTTGGGGG + Intronic
1051273324 9:15375680-15375702 ATGGCTCAGGGAACTAGAGATGG + Intergenic
1051703422 9:19850588-19850610 ATTGCTCAAGAAAATTTTGGGGG - Intergenic
1053119981 9:35539111-35539133 ATGGCTCAGGGAGCTGGGGGAGG + Intronic
1058495790 9:105557977-105557999 AGGGCTCAGTGAACTTCTGGCGG + Intergenic
1059804689 9:117786017-117786039 GGGCCTCAGAGAACTTTTGGGGG + Intergenic
1060397183 9:123324653-123324675 CTGCCTCAGGTAACTTCTGGTGG + Intergenic
1061397970 9:130353781-130353803 TTGGCTCTGGGGACTTTTGAAGG + Intronic
1061448997 9:130658811-130658833 GCGGCTCAGGGAAGTTGTGGAGG + Intergenic
1062578863 9:137221080-137221102 GTAGCTCAGGGAACTTTTCAGGG + Exonic
1185617770 X:1433712-1433734 AGGGTTCAGGGAGCTTCTGGTGG + Intronic
1188240072 X:27775377-27775399 CTGGCTCAAGGAAATTTTGGGGG + Intergenic
1189002566 X:36962398-36962420 ATGGCTCAGGGAACTGTTGGAGG - Intergenic
1190594843 X:52042125-52042147 AAGGGTCAGGGAACTTTTCTGGG + Intergenic
1190613981 X:52211948-52211970 AAGGGTCAGGGAACTTTTCTGGG - Intergenic
1190727854 X:53202708-53202730 ATTTCTCAGGAAACTGTTGGAGG - Intronic
1190846913 X:54201797-54201819 ATGAGTCAGTAAACTTTTGGGGG - Intronic
1192392168 X:70741453-70741475 GGGGCCAAGGGAACTTTTGGGGG + Intronic
1192546947 X:72022131-72022153 AGGGCTCAGGGCAGCTTTGGTGG - Intergenic
1195282003 X:103345208-103345230 TTGAGTCATGGAACTTTTGGGGG + Intergenic
1196505113 X:116433334-116433356 AGGCCTCAGGAAACTTATGGAGG + Intergenic
1197967229 X:132078238-132078260 TTGGCTCTGGGACCTTTTAGGGG + Exonic
1198078553 X:133217244-133217266 ATGGCTCAGGGAACTTTTGGAGG - Exonic
1198935592 X:141900068-141900090 ATGAGTCAGGGAACTTCTGCAGG - Intergenic
1199311459 X:146325661-146325683 AGGGCTTATGGAAATTTTGGGGG + Intergenic