ID: 1198082138

View in Genome Browser
Species Human (GRCh38)
Location X:133250277-133250299
Sequence GCCAGTAAGTCCTACAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198082138_1198082143 22 Left 1198082138 X:133250277-133250299 CCTGGTCTGTAGGACTTACTGGC No data
Right 1198082143 X:133250322-133250344 ATTAGAATGGTCATGGTGGAAGG No data
1198082138_1198082139 -3 Left 1198082138 X:133250277-133250299 CCTGGTCTGTAGGACTTACTGGC No data
Right 1198082139 X:133250297-133250319 GGCATCAAAGAAGTCTAGAATGG No data
1198082138_1198082142 18 Left 1198082138 X:133250277-133250299 CCTGGTCTGTAGGACTTACTGGC No data
Right 1198082142 X:133250318-133250340 GGTCATTAGAATGGTCATGGTGG No data
1198082138_1198082144 23 Left 1198082138 X:133250277-133250299 CCTGGTCTGTAGGACTTACTGGC No data
Right 1198082144 X:133250323-133250345 TTAGAATGGTCATGGTGGAAGGG No data
1198082138_1198082141 15 Left 1198082138 X:133250277-133250299 CCTGGTCTGTAGGACTTACTGGC No data
Right 1198082141 X:133250315-133250337 AATGGTCATTAGAATGGTCATGG No data
1198082138_1198082140 9 Left 1198082138 X:133250277-133250299 CCTGGTCTGTAGGACTTACTGGC No data
Right 1198082140 X:133250309-133250331 GTCTAGAATGGTCATTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198082138 Original CRISPR GCCAGTAAGTCCTACAGACC AGG (reversed) Intergenic
No off target data available for this crispr