ID: 1198084528

View in Genome Browser
Species Human (GRCh38)
Location X:133269562-133269584
Sequence ATTCTGCACTGATGGGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198084528_1198084534 10 Left 1198084528 X:133269562-133269584 CCCAAGTCCCATCAGTGCAGAAT No data
Right 1198084534 X:133269595-133269617 AGGCTGTTTGCTTTCTCCTGTGG No data
1198084528_1198084537 30 Left 1198084528 X:133269562-133269584 CCCAAGTCCCATCAGTGCAGAAT No data
Right 1198084537 X:133269615-133269637 TGGCCAAGGAAGATGTTGAATGG No data
1198084528_1198084533 -10 Left 1198084528 X:133269562-133269584 CCCAAGTCCCATCAGTGCAGAAT No data
Right 1198084533 X:133269575-133269597 AGTGCAGAATGATTGGACAAAGG No data
1198084528_1198084535 16 Left 1198084528 X:133269562-133269584 CCCAAGTCCCATCAGTGCAGAAT No data
Right 1198084535 X:133269601-133269623 TTTGCTTTCTCCTGTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198084528 Original CRISPR ATTCTGCACTGATGGGACTT GGG (reversed) Intergenic
No off target data available for this crispr