ID: 1198084529

View in Genome Browser
Species Human (GRCh38)
Location X:133269563-133269585
Sequence CATTCTGCACTGATGGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198084529_1198084537 29 Left 1198084529 X:133269563-133269585 CCAAGTCCCATCAGTGCAGAATG No data
Right 1198084537 X:133269615-133269637 TGGCCAAGGAAGATGTTGAATGG No data
1198084529_1198084534 9 Left 1198084529 X:133269563-133269585 CCAAGTCCCATCAGTGCAGAATG No data
Right 1198084534 X:133269595-133269617 AGGCTGTTTGCTTTCTCCTGTGG No data
1198084529_1198084535 15 Left 1198084529 X:133269563-133269585 CCAAGTCCCATCAGTGCAGAATG No data
Right 1198084535 X:133269601-133269623 TTTGCTTTCTCCTGTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198084529 Original CRISPR CATTCTGCACTGATGGGACT TGG (reversed) Intergenic
No off target data available for this crispr