ID: 1198084534

View in Genome Browser
Species Human (GRCh38)
Location X:133269595-133269617
Sequence AGGCTGTTTGCTTTCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198084529_1198084534 9 Left 1198084529 X:133269563-133269585 CCAAGTCCCATCAGTGCAGAATG No data
Right 1198084534 X:133269595-133269617 AGGCTGTTTGCTTTCTCCTGTGG No data
1198084528_1198084534 10 Left 1198084528 X:133269562-133269584 CCCAAGTCCCATCAGTGCAGAAT No data
Right 1198084534 X:133269595-133269617 AGGCTGTTTGCTTTCTCCTGTGG No data
1198084531_1198084534 3 Left 1198084531 X:133269569-133269591 CCCATCAGTGCAGAATGATTGGA No data
Right 1198084534 X:133269595-133269617 AGGCTGTTTGCTTTCTCCTGTGG No data
1198084532_1198084534 2 Left 1198084532 X:133269570-133269592 CCATCAGTGCAGAATGATTGGAC No data
Right 1198084534 X:133269595-133269617 AGGCTGTTTGCTTTCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198084534 Original CRISPR AGGCTGTTTGCTTTCTCCTG TGG Intergenic
No off target data available for this crispr