ID: 1198084535

View in Genome Browser
Species Human (GRCh38)
Location X:133269601-133269623
Sequence TTTGCTTTCTCCTGTGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198084528_1198084535 16 Left 1198084528 X:133269562-133269584 CCCAAGTCCCATCAGTGCAGAAT No data
Right 1198084535 X:133269601-133269623 TTTGCTTTCTCCTGTGGCCAAGG No data
1198084532_1198084535 8 Left 1198084532 X:133269570-133269592 CCATCAGTGCAGAATGATTGGAC No data
Right 1198084535 X:133269601-133269623 TTTGCTTTCTCCTGTGGCCAAGG No data
1198084529_1198084535 15 Left 1198084529 X:133269563-133269585 CCAAGTCCCATCAGTGCAGAATG No data
Right 1198084535 X:133269601-133269623 TTTGCTTTCTCCTGTGGCCAAGG No data
1198084531_1198084535 9 Left 1198084531 X:133269569-133269591 CCCATCAGTGCAGAATGATTGGA No data
Right 1198084535 X:133269601-133269623 TTTGCTTTCTCCTGTGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198084535 Original CRISPR TTTGCTTTCTCCTGTGGCCA AGG Intergenic
No off target data available for this crispr