ID: 1198087027

View in Genome Browser
Species Human (GRCh38)
Location X:133291595-133291617
Sequence GTGATCAATGCCTATATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1198087027_1198087033 14 Left 1198087027 X:133291595-133291617 CCTGCAATATAGGCATTGATCAC No data
Right 1198087033 X:133291632-133291654 ACCTCTTAACATTCTTATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1198087027 Original CRISPR GTGATCAATGCCTATATTGC AGG (reversed) Intergenic
No off target data available for this crispr